-
Notifications
You must be signed in to change notification settings - Fork 0
xiexiaowei/pgRNAFinder
Folders and files
Name | Name | Last commit message | Last commit date | |
---|---|---|---|---|
Repository files navigation
pgRNAFinder: a software package for designing both sgRNA (single guide RNA), paired nickase and pgRNA (paired guide RNA), as well as ranking the candidates by evaluating gRNA efficiency and potential off-target sites. ########################################################################################## Anyone can use the source codes or the excutable file of pgRNAFinder free of charge for non-commercial use. For commercial use, please contact the author. Please send bug reports to: xiexw3@mail2.sysu.edu.cn This README file covers the following topics: 1. Prerequest for pgRNAFinder 2. pgRNAFinder frame 3. Prepare pgRNAFinder input files 4. How to run pgRNAFinder and the usage of parameters 5. pgRNAFinder output files explanation ########################################################################################## 1. Prerequest for pgRNAFinder 1). Python 2.7 2). bedtools v2.25.0 fastaFromBed,intersectBed and groupBy were used. 3). SSC (SSC0.1) website: https://sourceforge.net/projects/spacerscoringcrispr/?source=typ_redirect install steps: download SSC0.1.tar.gz tar -zxvf SSC0.1.tar.gz run "make" in unzipped directory done 4). Off-Spotter_v0.2.2 website: https://cm.jefferson.edu/downloads/off-spotter-help/ install steps: download Off-Spotter_v0.2.2.zip unzip Off-Spotter_v0.2.2.zip run "make" in unzipped directory done Before running, you must build index by "Table_Creation" like this: Table_Creation -i fasta -o directory Table_Creation -i /data8/xiexw/gRNA_tool/genomes/hg19.fa -o /data8/xiexw/Off-Spotter/hg19/ 5). necessary reference files: ①. gennome sequence ②. gene position ③. exon region for on-target ④. fasta for Off-Spotter ⑤. exon region for Off-Spotter ⑥. phast conserved element ⑦. gene structure Corresponding files of ten genomes have been provided in ftp://222.200.187.83/genomes Current ten genomes: hg19, hg38, mm10, bosTau, canFam, danRer, galGal, ratNor, sacCer and susScr. More infomation about reference can be seen from "reference_README.txt" in the "Links" page of pgRNAFinder website. ########################################################################################## 2. pgRNAFinder frame pgRNAFinder is a software package, which contains these scripts as follows: 1). 01_get_sequence_for_search.py 2). 02_search_sgRNA.py 3). 03_get_sgRNA_candidate.py 4). 04_sgRNA_efficiency.py (It would call ontarget_phast.py) 5). 05_offtarget_for_sgRNA.py 6). 06_count_offtarget.py (Itwould call ontarget_phast_pgRNA.py and ontarget_phast.py) 7). 07_select_output.py 8). run.py Notice: run.py is the main script. All you need to do is running run.py, which will automatically call scripts from 01 to 07. The goals achieved by each step: script1. Getting fasta sequence from genomic region, gene name and target sequence. script2: Getting sgRNA followed by four common PAMs such as NGG, NAG, NNGRRT, NNNNACA and any self-definded PAM comprised of A,G,C,T,N,R. script3: Then, sgRNA having low-complexity sequence and specific restriction enzyme site will be discarded. script4. The remaining sgRNA will be submit to SSC for evaluating efficiency (restricted to human and mouse). At the same time, judging whether on-target sites locate in exon region and overlap with phast conserved element. script5. Getting off-target sites based on Off-Spotter for ten species. script6. Counting off-targets and off-targets located in exon for sgRNA. Combining pgRNA from sgRNA and counting off-targets and off-targets located in exon for pgRNA. At the same time, judging whether knockout regions of pgRNA locate in exon region and overlap with phast conserved element. script7. Counting CG content, pair distance, deletion frequency and coverage. Finally output the suitable pgRNA with user-defined parameters. ########################################################################################## 3. Prepare pgRNAFinder input pgRNAFinder permits three kinds of inputs: 1). genomic_region (chr:start-end) chr1:69091-70008 chr1:38605757-38605866 chr8:128752630-128753214 ... 2). gene name OR4F5 tert ... 3). target_sequence The file must have the following structure(fasta format). Notice: Header that starts with ">" and is followed by the unique sequence name with no space. >seq1 CTGC...GACGCT >seq2 CTTTCTTAAAG.. .....AAAGAGGC ########################################################################################## 4. How to run pgRNAFinder and the usage of parameters Usage: python run.py -i input -o output.txt -g genome -f flag -pam PAM -ul gRNA_length -dl downstream_length -enzys enzymes \ -s SSC_score -mis mismatch -gRNA type -ontarget ontarget -ota OTnum -ote OTnum_in_exon -cg CG -dis distance -cover coverage -strand strand -otsite yes,no Examples: 1). for----sg python run.py -i genomic_region.txt -o output.txt -g hg19 -f genomic_region -pam NGG -ul 20 -dl 7 -enzys no \ -s 0.5 -mis 2 -gRNA sg -ontarget all -ota 10 -ote 5 -cg 0.2~0.8 -otsite yes 2). for----pg python run.py -i genomic_region.txt -o output.txt -g hg19 -f genomic_region -pam NGG -ul 20 -dl 7 -enzys no \ -s 0.5 -mis 2 -gRNA pg -ontarget all -ota 10 -ote 5 -cg 0.2~0.8 -dis 0~1000 -cover 0.0~1.0 -strand all -otsite yes Options: -i <str> Input file -o <str> Output file -g <str> Genome: hg19, hg38, mm10, bosTau, canFam, danRer, galGal, ratNor, sacCer or susScr. -f <str> Flag: genomic_region, gene_name or target_sequence; should be consistent with the format of input. -pam <str> PAM sequence: NGG, NAG, NNGRRT, NNNNACA or self-definded sequence comprised of A,G,C,T,N,R -ul <int> gRNA length: the number of base in the upstream of PAM; at better >=20bp for off-target analysis -dl <int> Downstream length: the number of base in the downstream of PAM -enzys <str> Restriction enzyme:no enzyme or GAGACC or GAGACC,GGTCTC or self-defined like e1,e2,...en -s <float> SSC score: for evaluating gRNA efficiency, only SSC score higher than the cutoff will be reported. -mis <int> Mismatch of Off-Spotter when finding off-targets(at most): 0, 1, 2, 3, 4, 5 -gRNA <str> gRNA type: sg(for designing single gRNA) or pg(for designing paired gRNA) -ontarget <str> gRNA site: exon(>=1 gRNA located in exon) or all(report all gRNAs) -ota <int> Off-targets located in genome(at most): Only those gRNAs whose Off-targets is lower than the cutoff will be reported. -ote <int> Off-targets located in exon(at most): Lower is better. -cg <float> Minimum~Maximum value of GC content -dis <int> Minimum~Maximum distance between pgRNA -cover <float> Minimum~Maximum coverage: equal to distance between pgRNA divided by the length of sequence -strand <str> Strand: same(two gRNAs are in the same stand), diff(two gRNAs are in the different stand), both(report all gRNAs) -otsite <str> yes (output detailed off-target sites) or no (don't output detailed off-target sites) Advised options for better gRNAs: (some of which are also the default options of website) -ul >=20bp is recommended -s >0.5 is recommended -mis default is 2 -gRNA default is pg -ontarget exon is recommended; As for target sequence, here this option must be "all". -ota default is 10 -ote default is 5 -cg 0.2~0.8 is recommended -strand default: diff for paired nick; both for long pair -dis default: -2~32bp for paired nickase; 200~1000bp for paired guide RNA -cover default 0.0~1.0 ########################################################################################## 5. pgRNAFinder output files explanation 1) pgRNA: output example: (We advise you to view the output in excel.) query_info gRNA1 gRNA2 pos1 pos2 strand1 strand2 SSC_score1 SSC_score2 on_target1 on_target2 on_target_pair phastCE1 phastCE2 phastCE_pair ot_num1 ot_num2 ot_num_pair ot_num1_in_exon ot_num2_in_exon ot_num_pair_in_exon CG1 CG2 pair_dis cover del_freq ot_site1 ot_site2 chr1:67091-70091 GAGTGTGTAGGACTAAGAAATGGGATTCAG CAGAGTAGTAAAGAGAAAAGTGGAATTTCC 67351-67381 67378-67408 + + 0.51 0.54 non-exonic non-exonic non-exonic non-phastCE non-phastCE non-phastCE 2 5 1 0 0 0 0.43 0.37 3 0.00 1.00 {'chr19': '108940__non-exonic', 'chr15': '102464544__non-exonic'} {'chr13': '53296344__non-exonic', 'chr7': '24663568__non-exonic', 'chr19': '108967__non-exonic', 'chr3': '157860263__non-exonic', 'chr1': '210265930__non-exonic'} chr1:67091-70091 GAGTGTGTAGGACTAAGAAATGGGATTCAG CTATACCTTCATGTCTCCCGTGGAATGTTA 67351-67381 67490-67520 + + 0.51 0.56 non-exonic non-exonic non-exonic non-phastCE non-phastCE non-phastCE 2 2 2 0 0 0 0.43 0.43 109 0.04 0.89 {'chr19': '108940__non-exonic', 'chr15': '102464544__non-exonic'} {'chr19': '109079__non-exonic', 'chr15': '102464405__non-exonic'} ... There are 28 columns in this output file. Their meaning are: field Meaning query_info Name of input sequence gRNA1 Base sequence of one gRNA gRNA2 Base sequence of another pairwise gRNA pos1 Position of gRNA1 (the genome position for genomic_region and gene_name; the relative position in input sequence for target sequence) pos2 Position of gRNA2 strand1 Strand of gRNA1 strand2 Strand of gRNA2 SSC_score1 Efficiency score for gRNA1 by SSC software (This has two kinds: score or non-SSC. non-SSC means that gRNA length, PAM and species can't meet the request of SSC software.) SSC_score2 Efficiency score for gRNA2 by SSC software on_target1 On-target site of gRNA1 (This has three kinds: Ensemblid_genename_exon or non-exonic or unknown. non-exonic means that gRNA locates in non-coding region; unknown appears when flag is target_sequence.) on_target2 On-target site of gRNA2 on_target_pair On-target site of knockout region between pgRNA phastCE1 Phast conserved element overlapping with gRNA1 (This has three kinds: sum,count or non-phastCE or unknown. non-phastCE means no overlap with any phast conserved element; unknown appears when flag is target_sequence.) phastCE2 Phast conserved element overlapping with gRNA2 phastCE_pair Phast conserved element overlapping with knockout region between pgRNA ot_num1_in_exon The number of off-targets located in exon for gRNA1 ot_num2_in_exon The number of off-targets located in exon for gRNA2 ot_num_pair_in_exon The number of off-targets located in exon for pgRNA (>=1 off-target located in exon) ot_num1 The number of off-targets for gRNA1 ot_num2 The number of off-targets for gRNA2 ot_num_pair The number of off-targets for pgRNA (>=1 off-target located in exon) CG1 CG content of gRNA1 CG2 CG content of gRNA2 pair_dis Distance between pgRNA cover Coverage of pgRNA del_freq Deletion frequency, this value depends on the distance between pgRNA ot_site1 Detailed off-target sites for gRNA1 ot_site2 Detailed off-target sites for gRNA2 2) single gRNA: output example: (We advise you to view the output in excel.) query_info gRNA pos strand SSC_score on_target phastCE ot_num ot_num_in_exon CG ot_site chr1:69091-70008 CCACTGTTATGACAATAAGAAGGTTTCCAA 69187 - 0.59 ENSG00000186092.4_OR4F5_exon (1466,5) 3 2 0.37 {'chr19': '110783__ENSG00000176695.5_OR4F17_exon', 'chr3': '122986852__non-exonic', 'chr15': '102463136__ENSG00000177693.3_OR4F4_exon'} chr1:69091-70008 GTACATGGGAGAGTGAAGGTGGGAGTCAGA 69219 - 0.55 ENSG00000186092.4_OR4F5_exon (746,2) 5 4 0.53 {'chr7': '142760355__ENSG00000179420.10_OR6W1P_exon', 'chr11': '7795190__ENSG00000166408.3_OR5P1P_exon', 'chr19': '110815__ENSG00000176695.5_OR4F17_exon', 'chr15': '102463104__ENSG00000177693.3_OR4F4_exon', 'chr2': '13424__non-exonic'} ... Explanation is the similar to above.
About
design distance independent paired-gRNA
Resources
Stars
Watchers
Forks
Releases
No releases published
Packages 0
No packages published