Skip to content

Commit

Permalink
chore: update README.md
Browse files Browse the repository at this point in the history
  • Loading branch information
@tzok
tzok committed Dec 12, 2024
1 parent db69371 commit 1b9430a
Showing 1 changed file with 94 additions and 48 deletions.
142 changes: 94 additions & 48 deletions README.md
View file
Original file line number Diff line number Diff line change
Expand Up @@ -129,12 +129,12 @@ induced by 5’-3’ indexing. We select permutation with the minimum value.

Chain order: 1
n4-helix with 3 tetrads
Oh* V,VI 9a -(pll) quadruplex with 3 tetrads
Oh* V 9a -(pll) quadruplex with 3 tetrads
1.DG4 1.DG22 1.DG18 1.DG10 cWH cWH cWH cWH O- Vb planarity=0.17
direction=hybrid rise=3.21 twist=16.23
1.DG5 1.DG23 1.DG17 1.DG11 cHW cHW cHW cHW O+ Va planarity=0.1
direction=hybrid rise=3.11 twist=27.45
1.DG6 1.DG24 1.DG16 1.DG12 cHW cHW cHW cHW O+ VIa planarity=0.18
1.DG6 1.DG24 1.DG16 1.DG12 cHW cHW cHW cHW O+ Va planarity=0.18

Tracts:
1.DG4, 1.DG5, 1.DG6
Expand All @@ -148,11 +148,13 @@ induced by 5’-3’ indexing. We select permutation with the minimum value.
lateral+ 1.DT19, 1.DT20, 1.DA21

AAAGGGTTAGGGTTAGGGTTAGGGAA
...([{...(((...)))...)]}..
...([{...)]}...(((...)))..
...(([...{)]...[[}...)]]..
...([{...)((...))(...)]}..

<details>

<summary>

Click to see the output JSON
</summary>

Expand Down Expand Up @@ -235,7 +237,7 @@ Click to see the output JSON
"fullName": "1.DT7",
"shortName": "T",
"chi": -63.10830751967371,
"glycosidicBond": "syn"
"glycosidicBond": "anti"
},
{
"index": 8,
Expand Down Expand Up @@ -290,7 +292,7 @@ Click to see the output JSON
"fullName": "1.DG12",
"shortName": "G",
"chi": -84.36679807284759,
"glycosidicBond": "syn"
"glycosidicBond": "anti"
},
{
"index": 13,
Expand All @@ -301,7 +303,7 @@ Click to see the output JSON
"fullName": "1.DT13",
"shortName": "T",
"chi": -30.819029132834157,
"glycosidicBond": "syn"
"glycosidicBond": "anti"
},
{
"index": 14,
Expand Down Expand Up @@ -389,7 +391,7 @@ Click to see the output JSON
"fullName": "1.DA21",
"shortName": "A",
"chi": -89.07113063649612,
"glycosidicBond": "syn"
"glycosidicBond": "anti"
},
{
"index": 22,
Expand Down Expand Up @@ -433,7 +435,7 @@ Click to see the output JSON
"fullName": "1.DA25",
"shortName": "A",
"chi": -58.323530637551954,
"glycosidicBond": "syn"
"glycosidicBond": "anti"
},
{
"index": 26,
Expand Down Expand Up @@ -583,7 +585,7 @@ Click to see the output JSON
"nt3": "1.DG16",
"nt4": "1.DG12",
"onz": "O+",
"gbaClassification": "VIa",
"gbaClassification": "Va",
"planarityDeviation": 0.18293509778060615,
"ionsChannel": [],
"ionsOutside": []
Expand All @@ -595,8 +597,7 @@ Click to see the output JSON
"loopProgression": "-(pll)"
},
"gbaClassification": [
"V",
"VI"
"V"
],
"tracts": [
[
Expand Down Expand Up @@ -668,8 +669,14 @@ Click to see the output JSON
],
"dotBracket": {
"sequence": "AAAGGGTTAGGGTTAGGGTTAGGGAA",
"line1": "...([{...(((...)))...)]}..",
"line2": "...([{...)]}...(((...))).."
"line1": "...(([...{)]...[[}...)]]..",
"line2": "...([{...)((...))(...)]}.."
},
"quadruplexDotBracket": {
"sequence": "AAAGGGTTAGGGTTAGGGTTAGGGAA",
"structure": "...qRS...Qrs...SRq...Qrs..",
"chi": "saasaaaaasaaaaassaaaasaaaa",
"loop": "......ppp...lll...LLL....."
}
}
```
Expand All @@ -686,7 +693,7 @@ Click to see the output JSON
Chain order: A AB AA AC B BC BA BB
n4-helix with 10 tetrads
Op* VIII n/a quadruplex with 5 tetrads
A.U1006 AC.U1006 AA.U1006 AB.U1006 cWH cWH cWH cWH O- VIIIa planarity=1.06 ions_channel=NA ions_outside=A.U1006: [SR] AA.U1006: [SR] AB.U1006: [SR] AC.U1006: [SR]
A.U1006 AC.U1006 AA.U1006 AB.U1006 cWH cWH cWH cWH O- VIIIa planarity=1.06 ions_outside=A.U1006: [SR] AA.U1006: [SR] AB.U1006: [SR] AC.U1006: [SR]
direction=parallel rise=3.37 twist=39.96
A.G1005 AC.G1005 AA.G1005 AB.G1005 cHW cHW cHW cHW O+ VIIIa planarity=0.8
direction=parallel rise=3.31 twist=25.9
Expand All @@ -709,7 +716,7 @@ Click to see the output JSON
direction=parallel rise=3.32 twist=35.04
B.G2004 BC.G2004 BA.G2004 BB.G2004 cWH cWH cWH cWH O+ VIIIa planarity=0.23 ions_channel=SR
direction=parallel rise=3.27 twist=25.15
B.G2005 BC.G2005 BA.G2005 BB.G2005 cWH cWH cWH cWH O+ VIIIa planarity=0.78 ions_channel=NA
B.G2005 BC.G2005 BA.G2005 BB.G2005 cWH cWH cWH cWH O+ VIIIa planarity=0.78
direction=parallel rise=7.14 twist=43.41
B.U2006 BC.U2006 BA.U2006 BB.U2006 cHW cHW cHW cHW O- VIIIa planarity=1.58 ions_channel=NA,NA

Expand All @@ -719,12 +726,14 @@ Click to see the output JSON
BA.G2002, BA.G2003, BA.G2004, BA.G2005, BA.U2006
BB.G2002, BB.G2003, BB.G2004, BB.G2005, BB.U2006

UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU
.([{<A-.([{<A-.)]}>a-.)]}>a-.([{<A-.)]}>a-.([{<A-.)]}>a
.([{<A-.)]}>a-.([{<A-.)]}>a-.([{<A-.([{<A-.)]}>a-.)]}>a
UGGGG-UUGGGG-UUGGGG-UUGGGG-UUGGGG-UUGGGG-UUGGGG-UUGGGGU
.([{<-A.)]}>-(.[{<A-).]}>a-a.([{<-A.)]}>-(.[{<A-).]}>aa
.([{<-(.[{<A-).]}>a-A.)]}>-a.([{<-(.[{<A-).]}>a-A.)]}>a

<details>

<summary>

Click to see the output JSON
</summary>

Expand All @@ -737,11 +746,11 @@ Click to see the output JSON
},
{
"symbol": "Na",
"count": 4
"count": 2
},
{
"symbol": "Ca",
"count": 12
"count": 8
}
],
"nucleotides": [
Expand Down Expand Up @@ -1303,6 +1312,20 @@ Click to see the output JSON
"inTetrad": true,
"canonical": false
},
{
"nt1": "A.G1003",
"nt2": "AC.G1004",
"lw": "cSS",
"inTetrad": false,
"canonical": false
},
{
"nt1": "A.G1004",
"nt2": "AB.G1003",
"lw": "cSS",
"inTetrad": false,
"canonical": false
},
{
"nt1": "A.G1004",
"nt2": "AB.G1004",
Expand Down Expand Up @@ -1366,6 +1389,13 @@ Click to see the output JSON
"inTetrad": true,
"canonical": false
},
{
"nt1": "AB.G1004",
"nt2": "AA.G1003",
"lw": "cSS",
"inTetrad": false,
"canonical": false
},
{
"nt1": "AA.G1003",
"nt2": "AC.G1003",
Expand All @@ -1380,6 +1410,13 @@ Click to see the output JSON
"inTetrad": true,
"canonical": false
},
{
"nt1": "AA.G1004",
"nt2": "AC.G1003",
"lw": "cSS",
"inTetrad": false,
"canonical": false
},
{
"nt1": "AA.G1004",
"nt2": "AC.G1004",
Expand Down Expand Up @@ -1513,6 +1550,13 @@ Click to see the output JSON
"inTetrad": true,
"canonical": false
},
{
"nt1": "BC.G2004",
"nt2": "BA.G2003",
"lw": "cSS",
"inTetrad": false,
"canonical": false
},
{
"nt1": "BA.G2004",
"nt2": "BB.G2004",
Expand Down Expand Up @@ -1570,25 +1614,23 @@ Click to see the output JSON
"onz": "O-",
"gbaClassification": "VIIIa",
"planarityDeviation": 1.061,
"ionsChannel": [
"NA"
],
"ionsChannel": [],
"ionsOutside": [
{
"nt": "A.U1006",
"ion": "SR"
"ion": "Sr"
},
{
"nt": "AA.U1006",
"ion": "SR"
"ion": "Sr"
},
{
"nt": "AB.U1006",
"ion": "SR"
"ion": "Sr"
},
{
"nt": "AC.U1006",
"ion": "SR"
"ion": "Sr"
}
]
},
Expand All @@ -1614,7 +1656,7 @@ Click to see the output JSON
"gbaClassification": "VIIIa",
"planarityDeviation": 0.4059999999999988,
"ionsChannel": [
"SR"
"Sr"
],
"ionsOutside": []
},
Expand All @@ -1628,7 +1670,7 @@ Click to see the output JSON
"gbaClassification": "VIIIa",
"planarityDeviation": 0.5549999999999997,
"ionsChannel": [
"SR"
"Sr"
],
"ionsOutside": []
},
Expand All @@ -1645,19 +1687,19 @@ Click to see the output JSON
"ionsOutside": [
{
"nt": "AB.G1002",
"ion": "CA"
"ion": "Ca"
},
{
"nt": "AC.G1002",
"ion": "CA"
"ion": "Ca"
},
{
"nt": "AA.G1002",
"ion": "CA"
"ion": "Ca"
},
{
"nt": "A.G1002",
"ion": "CA"
"ion": "Ca"
}
]
}
Expand Down Expand Up @@ -1723,24 +1765,24 @@ Click to see the output JSON
"gbaClassification": "VIIIa",
"planarityDeviation": 0.5769999999999982,
"ionsChannel": [
"SR"
"Sr"
],
"ionsOutside": [
{
"nt": "B.G2003",
"ion": "CA"
"ion": "Ca"
},
{
"nt": "BA.G2003",
"ion": "CA"
"ion": "Ca"
},
{
"nt": "BB.G2003",
"ion": "CA"
"ion": "Ca"
},
{
"nt": "BC.G2003",
"ion": "CA"
"ion": "Ca"
}
]
},
Expand All @@ -1754,7 +1796,7 @@ Click to see the output JSON
"gbaClassification": "VIIIa",
"planarityDeviation": 0.2289999999999992,
"ionsChannel": [
"SR"
"Sr"
],
"ionsOutside": []
},
Expand All @@ -1767,9 +1809,7 @@ Click to see the output JSON
"onz": "O+",
"gbaClassification": "VIIIa",
"planarityDeviation": 0.7810000000000006,
"ionsChannel": [
"NA"
],
"ionsChannel": [],
"ionsOutside": []
},
{
Expand All @@ -1782,8 +1822,8 @@ Click to see the output JSON
"gbaClassification": "VIIIa",
"planarityDeviation": 1.5840000000000005,
"ionsChannel": [
"NA",
"NA"
"Na",
"Na"
],
"ionsOutside": []
}
Expand Down Expand Up @@ -1894,9 +1934,15 @@ Click to see the output JSON
}
],
"dotBracket": {
"sequence": "UGGGG-UUGGGG-UUGGGG-UUGGGG-UUGGGG-UUGGGG-UUGGGG-UUGGGGU",
"line1": ".([{<-A.)]}>-(.[{<A-).]}>a-a.([{<-A.)]}>-(.[{<A-).]}>aa",
"line2": ".([{<-(.[{<A-).]}>a-A.)]}>-a.([{<-(.[{<A-).]}>a-A.)]}>a"
},
"quadruplexDotBracket": {
"sequence": "UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU-UGGGGU",
"line1": ".([{<A-.([{<A-.)]}>a-.)]}>a-.([{<A-.)]}>a-.([{<A-.)]}>a",
"line2": ".([{<A-.)]}>a-.([{<A-.)]}>a-.([{<A-.([{<A-.)]}>a-.)]}>a"
"structure": ".QRSTu-.qrstU-.QRSTu-.qrstU-.VWXYz-.vwxyZ-.VWXYz-.vwxyZ",
"chi": "aaaaaa-aaaaaa-aaaaaa-aaaaaa-aaaaaa-aaaaaa-aaaaaa-aaaaaa",
"loop": "......-......-......-......-......-......-......-......"
}
}
```
Expand Down Expand Up @@ -1931,7 +1977,7 @@ intramural financing program.
3. R-Chie : A Web Server and R Package for Visualizing RNA Secondary
Structures. D. Lai, J.R. Proctor, J.Y.A. Zhu, I.M. Meyer. *Nucleic
Acids Research*. 2012. 40(12):e95.
doi:[f99845](https://doi.org/f99845)
doi:[10/f99845](https://doi.org/10/f99845)

4. Geometric Nomenclature and Classification of RNA Base Pairs. N.B.
Leontis, E. Westhof. *RNA*. 2001. 7(4):499–512.
Expand Down

0 comments on commit 1b9430a

Please sign in to comment.