Fix newlines in sketch kmers

onecodex · Jan 15, 2024 · 47850b0 · 47850b0
2 parents fc85af0 + 1539f73
commit 47850b0
Show file tree

Hide file tree

Showing 8 changed files with 69 additions and 15 deletions.
diff --git a/Cargo.lock b/Cargo.lock
diff --git a/cli/Cargo.toml b/cli/Cargo.toml
@@ -16,7 +16,7 @@ path = "src/main.rs"
 
 [dependencies]
 clap = "2.33.0"
-finch = "0.6"
+finch = { version = "0.6.1", path = "../lib" }
 serde_json = "1"
 anyhow = "1"
 

diff --git a/cli/tests/data/query.fa b/cli/tests/data/query.fa
@@ -1,6 +1,12 @@
 >id1
-AAGGCCTAACTTAATAGGCCCGTATAAATTAGAGCTAGCTAGCTAGTCGATCGATGCTAGCTACGTAACGTCGCGATCGATTATATTCCTCGGCGCGATATTCGCTAGCTAGCTAGCTAGTCATCGATGCATG
+AAGGCCTAACTTAATAGGCCCGTATAAATTAGAGCTAGCTAGCTAGTCGATCGATGCTAGCTAC
+GTAACGTCGCGATCGATTATATTCCTCGGCGCGATATTCGCTAGCTAGCTAGCTAGTCATCGATGCATG
 >id2
-AAGGCCTAACTTAATAGGCCCGTATAAATTAGAAGTAGATGATAGATGTGTAGTAGTAGACCGGCTCAGCATCTGAGTCATGCTAGTCGATCGATCGTAGCTAGCGATGCTAGCTAGCTAGCTGTAGCTGCAT
+AAGGCCTAACTTAATAGGCCCGTATAAATT
+AGAAGTAGATGAT
+AGATGTGTAGTAGTAGACCGGCTCAGCATCTGAGTCATGCTAGTCGATCGATCGTAGCTAGCGATGCTAGCTAGCTAGC
+TGTAGCTGCAT
 >id3
-GATGCTGCATGCTACAGCGATGCTAGCTGATGCTAGCTACATTACGAGGCGGCATCTATCAGTCGATCGATCGTAGCTGATCGATCGATGCTGATCGATGCTACATGCTCAGTCGATGCTAGCATGTCAGTCG
+GATGCTGCATGCTACA
+GCGATGCTAGCTGATGCTAGCTACATTACGAGGCGGC
+ATCTATCAGTCGATCGATCGTAGCTGATCGATCGATGCTGATCGATGCTACATGCTCAGTCGATGCTAGCATGTCAGTCG
diff --git a/cli/tests/test_cli.rs b/cli/tests/test_cli.rs
@@ -93,6 +93,55 @@ fn finch_sketch_scaled() -> Result<(), Box<dyn std::error::Error>> {
     assert_eq!(sketch["kmer"], 21);
     assert_eq!(sketch["alphabet"], "ACGT");
     assert_eq!(sketch["sketchSize"], 10);
+
+    let kmers = &sketch["sketches"][0]["kmers"];
+
+    assert_eq!(kmers[0], "ATGCTAGCTACGTAACGTCGC");
+    assert_eq!(kmers[1], "CAGTCGATCGATCGTAGCTGA");
+    assert_eq!(kmers[2], "CTCAGATGCTGAGCCGGTCTA");
+    assert_eq!(kmers[3], "GCTAGCTAGCATCGCTAGCTA");
+    assert_eq!(kmers[4], "GACTAGCTAGCTAGCTAGCGA");
+    assert_eq!(kmers[5], "CGCTAGCTACGATCGATCGAC");
+    assert_eq!(kmers[6], "TAATTTATACGGGCCTATTAA");
+    assert_eq!(kmers[7], "GCATCAGCTAGCATCGCTGTA");
+    assert_eq!(kmers[8], "AGCCGGTCTACTACTACACAT");
+    assert_eq!(kmers[9], "AAGGCCTAACTTAATAGGCCC");
+
+    //assert_eq!(sketch["max_hash"], usize::max_value() / 1000);
+    assert_eq!(sketch["hashSeed"], 0);
+
+    Ok(())
+}
+
+#[test]
+fn finch_sketch_mash() -> Result<(), Box<dyn std::error::Error>> {
+    let mut cmd = Command::cargo_bin("finch")?;
+    cmd.arg("sketch")
+        .args(&["--n-hashes", "10"])
+        .args(&["--sketch-type", "mash"])
+        .arg("tests/data/query.fa")
+        .arg("-O");
+    cmd.assert().success();
+
+    let output = Cursor::new(cmd.output().unwrap().stdout);
+    let sketch: serde_json::Value = serde_json::from_reader(output)?;
+    assert_eq!(sketch["kmer"], 21);
+    assert_eq!(sketch["alphabet"], "ACGT");
+    assert_eq!(sketch["sketchSize"], 10);
+
+    let kmers = &sketch["sketches"][0]["kmers"];
+
+    assert_eq!(kmers[0], "ATGCTAGCTACGTAACGTCGC");
+    assert_eq!(kmers[1], "CAGTCGATCGATCGTAGCTGA");
+    assert_eq!(kmers[2], "CTCAGATGCTGAGCCGGTCTA");
+    assert_eq!(kmers[3], "GCTAGCTAGCATCGCTAGCTA");
+    assert_eq!(kmers[4], "GACTAGCTAGCTAGCTAGCGA");
+    assert_eq!(kmers[5], "CGCTAGCTACGATCGATCGAC");
+    assert_eq!(kmers[6], "TAATTTATACGGGCCTATTAA");
+    assert_eq!(kmers[7], "GCATCAGCTAGCATCGCTGTA");
+    assert_eq!(kmers[8], "AGCCGGTCTACTACTACACAT");
+    assert_eq!(kmers[9], "AAGGCCTAACTTAATAGGCCC");
+
     //assert_eq!(sketch["max_hash"], usize::max_value() / 1000);
     assert_eq!(sketch["hashSeed"], 0);
 

diff --git a/lib/Cargo.toml b/lib/Cargo.toml
@@ -1,6 +1,6 @@
 [package]
 name = "finch"
-version = "0.6.0"
+version = "0.6.1"
 authors = ["One Codex <vincent@onecodex.com>"]
 description = "An implementation of min-wise independent permutation locality sensitive hashing ('MinHashing') for genomic data and command-line utility for manipulation."
 keywords = ["minhash", "bioinformatics", "sketches"]

diff --git a/lib/src/serialization/json.rs b/lib/src/serialization/json.rs
@@ -9,7 +9,6 @@ use serde::{Deserialize, Serialize};
 use crate::bail;
 use crate::errors::FinchResult;
 use crate::filtering::FilterParams;
-pub use crate::serialization::mash::{read_mash_file, write_mash_file};
 use crate::serialization::Sketch;
 use crate::sketch_schemes::{KmerCount, SketchParams};
 

diff --git a/lib/src/sketch_schemes/mash.rs b/lib/src/sketch_schemes/mash.rs
@@ -71,10 +71,10 @@ impl SketchScheme for MashSketcher {
         'seq: 'inner,
     {
         self.total_bases += seq.sequence().len() as u64;
-        let rc = seq.reverse_complement();
-        for (_, kmer, is_rev_complement) in
-            seq.normalize(false).canonical_kmers(self.kmer_length, &rc)
-        {
+        let norm_seq = seq.normalize(false);
+
+        let rc = norm_seq.reverse_complement();
+        for (_, kmer, is_rev_complement) in norm_seq.canonical_kmers(self.kmer_length, &rc) {
             let rc_count = u8::from(is_rev_complement);
             self.push(kmer, rc_count);
         }

diff --git a/lib/src/sketch_schemes/scaled.rs b/lib/src/sketch_schemes/scaled.rs
@@ -69,10 +69,10 @@ impl SketchScheme for ScaledSketcher {
         'seq: 'inner,
     {
         self.total_bases += seq.sequence().len() as u64;
-        let rc = seq.reverse_complement();
-        for (_, kmer, is_rev_complement) in
-            seq.normalize(false).canonical_kmers(self.kmer_length, &rc)
-        {
+        let norm_seq = seq.normalize(false);
+
+        let rc = norm_seq.reverse_complement();
+        for (_, kmer, is_rev_complement) in norm_seq.canonical_kmers(self.kmer_length, &rc) {
             let rc_count = u8::from(is_rev_complement);
             self.push(kmer, rc_count);
         }