scNanoGPS is a computational toolkit for analyzing high throughput single cell nanopore sequencing data to detect Genotypes and Phenotype Simultaneously from same cells. scNanoGPS includes 5 major steps: 1) NanoQC to perform quality control of the raw seqeucning data; 2) Scanner to scan and filter out reads that do not have expected adapater sequence patterns, i.e., TrueSeq Read 1 adapter sequence, TSO adaper sequence, poly (A/T)n block sequence, Cell Barcodes (CB) and unique molecule identifier (UMI) sequence blocks; 3) Assigner to detect the list of true cell barcodes, merge cell barcodes with sequencing errors and assign raw reads into single cells; 4) Curator to detect reads with true UMIs and collapse them to make consensus sequences of individual molecules to curate sequencing errors on gene bodies; 5) Reporter to detect single cell transcriptomes, single cell gene isoforms and single cell mutations from consensus single cell long reads data.
Single cell, Nanopore, RNA sequencing, long read, cell barcode demultiplex, UMI curation, gene expression, isoform, single nucleotide variation
Shiau, CK., Lu, L., Kieser, R. et al. High throughput single cell long-read sequencing analyses of same-cell genotypes and phenotypes in human tumors. Nat Commun 14, 4124 (2023). https://doi.org/10.1038/s41467-023-39813-7
The scNanoGPS pipeline is built with python3. We recommend users to use anaconda/miniconda virtual environment to install it. Refer to Anaconda turorial for environment building.
- Example codes for creating and activating python3 environment on Linux-based OS:
conda create -n scNanoGPS python=3 numpy scipy source activate scNanoGPS
-
The scNanoGPS requires the following dependencies to work:
- biopython 1.79 - distance 0.1.3 - matplotlib 3.5.2 - pandas 1.4.2 - pysam 0.19.0 - seaborn 0.11.2
-
Example codes for obtaining scNanoGPS from GitHub and installation of dependencies:
git clone https://github.com/gaolabtools/scNanoGPS/ cd scNanoGPS pip3 install -r requirements.txt
scNanoGPS uses the following third party tools for mapping again genome reference, collapsing reads with same UMIs, and sumamrizing single cell gene expression, isoform, and SNV profiles.
- Example codes for installation of third party tools
- minimap2 (GitHub, Anaconda)
conda install -c bioconda minimap2
- Samtools (GitHub, Anaconda)
conda install -c bioconda samtools
- tabix (Anaconda)
conda install -c bioconda tabix
- SPOA (GitHub, Anaconda)
conda install -c bioconda spoa
- SubRead featureCounts (SourceForge, Anaconda)
# You can download and unzip pre-compiled binary file from https://sourceforge.net/projects/subread/files/subread-2.0.3/ tar -xzf subread-2.0.3-<platform>.tar.gz # or install subread via anaconda conda install -c bioconda subread
- LIQA (GitHub)
pip3 install liqa
- Longshot (GitHub, Anaconda)
conda install -c bioconda longshot
- BCFtools (GitHub, Anaconda)
conda install -c bioconda bcftools
- ANNOVAR
# You can download ANNOVAR from https://www.openbioinformatics.org/annovar/annovar_download_form.php tar -xvf annovar.latest.tar.gz
- (optional) gffread (GitHub)
git clone https://github.com/gpertea/gffread cd gffread make release
- Qualimap (Anaconda)
# You can download Qualimap from http://qualimap.conesalab.org/ unzip qualimap_v2.2.1.zip # or install qualimap via anaconda conda install -c bioconda qualimap
- minimap2 (GitHub, Anaconda)
-
Reference genome
Users can obtain reference genome from NCBI, Ensembl, or any other autoritieswget https://ftp.ensembl.org/pub/release-100/fasta/homo_sapiens/dna/Homo_sapiens.GRCh38.dna.toplevel.fa.gz
-
Gene annotation (GTF/GFF)
Users can obtain reference gene annotations from NCBI, Ensembl, or any other autoritieswget https://ftp.ensembl.org/pub/release-100/gtf/homo_sapiens/Homo_sapiens.GRCh38.100.gtf.gz
- Note: Many tools cannot use compressed GTF file. Please try to gunzip compress GTF.gz beforehand.
-
Index reference genome for minimap2
Prepare indexed genome for minimap2 to boost mapping. Refer to the Minimap2 instruction.- Example code:
minimap2 -x map-ont -d example/GRCh38_chr22.mmi example/GRCh38_chr22.fa.gz
- Example code:
-
Index reference genome for LIQA
This version of scNanoGPS uses LIQA as a default tool to calculate single cell isoforms. Refer to the LIQA's manual for complete instructions- Example code:
liqa -task refgene -ref example/GRCh38_chr22.gtf -format gtf -out example/GRCh38_chr22.liqa.refgene
- Example code:
-
Annotation tables for ANNOVAR
This version of scNanoGPS uses ANNOVAR to annotate single cell SNVs results, please refer to ANNOVAR's webpage for more information.- Example codes:
perl annotate_variation.pl -buildver hg38 -downdb -webfrom annovar refGene hg38db/ perl annotate_variation.pl -buildver hg38 -downdb cytoBand hg38db/ perl annotate_variation.pl -buildver hg38 -downdb -webfrom annovar gnomad30_genome hg38db/ perl annotate_variation.pl -buildver hg38 -downdb -webfrom annovar avsnp150 hg38db/ perl annotate_variation.pl -buildver hg38 -downdb -webfrom annovar dbnsfp42c hg38db/
Please re-use the master script "run_scNanoGPS.sh" for your convenience. Make sure to update the path inside the master script with any text editor you like, then run the script with the following command.
sh run_scNanoGPS.sh
By default, the matrices of gene expression, isoform, and SNV (single nucleotide variation) are under scNanoGPS_res. There is also a summary report under scNanoGPS_res named "summary.txt"
If you prefer to run each components of scNanoGPS step-by-step, the following tutorial can walk you through all the components of scNanoGPS.
scNanoGPS contains a script named “read_length_profiler.py” to compute the raw read lengths of all reads. The script can either read through individual FastQ/Fast5 files or all FastQ/Fast5 files under a given folder. The raw read length histogram is drawn accordingly.
-
Manual of read_length_profiler.py
python3 other_utils/read_length_profiler.py -h Usage: read_length_profiler.py [options] Options: -h, --help show this help message and exit -i FQ_F_NAME File or folder name of reads. -d O_DIR Output directory name. Default: scNanoGPS_res -f FIG_NAME Read length histogram file name. Default: read_length.png -o O_NAME Read length file name. Default: read_length.tsv.gz --fig_w=FIG_W Width of figure (inch). Default: 12 --fig_h=FIG_H Height of figure (inch). Default: 7
-
Example code:
python3 other_utils/read_length_profiler.py -i example/fastq/
Per the experimental design of read architecture, the TruSeq Read1, cell barcode (CB), unique molecular identifier (UMI), and polyA tail are expected to locate either in the first or the last 100 nucleotide range of each Nanopore read. Users can use FastQC to check the qualities of the first and last 100 nucleotides of individual Nanopore reads to draw the per-base quality score boxplot.
-
Manual of prepare_read_qc.py
Usage: prepare_read_qc.py [options] Options: -h, --help show this help message and exit -i FQ_F_NAME File or folder name of reads. -d O_DIR Output directory name. Default: scNanoGPS_res -l READ_LEN Length of the extracted first and last read nucleotides. Default: 100 --o1=O1 First given length of reads. Default: first_tail.fastq.gz --o2=O2 Last given length of reads. Default: last_tail.fastq.gz
-
Example code:
python3 other_utils/prepare_read_qc.py -i example/fastq/
You can run FastQC to check first_tail.fastq.gz and last_tail.fastq.gz for quality score distribution.
This step of scNanoGPS pipeline is executed by a python script called “scanner.py”. This script scans for both TruSeq Read1 and polyA tail of the reads. Scanning for other sequence modules are optional. To boost the scanning speed, we scan the first and last 100 nucleotides of reads to recognize TruSeq Read 1 and PolyA. Following by recognition, Scanner extracts CBs and UMIs which are neighbored by TruSeq Read 1 and Poly(A/T)n sequence blocks. Then the Scanner outputs two different files. One is a processed FastQ file holding the insert sequences without TruSeq Read 1, CB, and UMI sequences. The CBs of individual reads are moved to the read names as tags. The other file is table named, “barcode_list.tsv”, storing reads information including read names, CBs, UMIs, and others.
-
Manual of scanner.py
python3 scanner.py -h Usage: scanner.py [options] Options: -h, --help show this help message and exit -i FQ_F_NAME * Required ! Input FastQ/Fast5 file name, or directory containing multiple input files. Support fastq/fq/fastq.gz/fq.gz/fast5 format. -o FQ_O_NAME Output fastq file name. Could be either in .fastq or .gz format.Default: processed.fastq.gz -d O_DIR Output directory name. Must give a new directory name to prevent accidental overwriting ! Default: scNanoGPS_res -b BC_F_NAME Output cell barcode list file. Default: barcode_list.tsv.gz -t NCORES Number of cores for program running. Default: 1 --log=LOG_F_NAME Program log file. This file stores program running parameters and counting details. Default: scanner.log.txt --a5=ADAPTOR_FIVE_P Sequence of 5'-adaptor. Default: AAGCAGTGGTATCAACGCAGAGTACAT --a3=ADAPTOR_THREE_P Sequence of 3'-adaptor. Default: CTACACGACGCTCTTCCGATCT --pT=POLYT Reverse-complement sequence of polyA. Default: TTTTTTTTTTTT --lCB=BC_LEN Length of cell barcode. Default: 16 --lUMI=UMI_LEN Length of UMI. Default: 12 --min_read_length=MIN_READ_LENGTH Minimal read length. Default: 200 --editing_distance=ALLOW_EDITING_DISTANCE Editing distance for cell barcode detection. Default: 2 --matching_threshold=MATCHING_PERCENTAGE Matching threshold for alignment search. Default: 0.7 --score_threshold=SCORING_THRESHOLD Scoring threshold for alignment search. Default: 0.4 --batching_no=BATCH_NO Number of reads for batch processing. Default: 1000 --scanning_region=SCAN_REGION Region length for adaptor scanning. Default: 100 --debug_mode=DEBUG_MODE Debug mode switch. Default: False --penalty_matching=DP_MA Dynamic programming matching penalty. Default: 2 --penalty_mismatching=DP_MI Dynamic programming mismatching penalty. Default: -3 --penalty_gap_opening=DP_GO Dynamic programming gap opening penalty. Default: -5 --penalty_gap_extention=DP_GE Dynamic programming gap extention penalty. Default: -2
-
Example code:
python3 scanner.py -i example/fastq/ -t 2
This step of scNanoGPS pipeline is executed by a python script called “assigner.py”. This script is designed for CB collapsing and estimation of the optimal CB number without guidance of 10X short-read sequencing data or any CB whitelist. To estimate the number of optimal CB, we use edge detection strategy to find out the point where has dramatical signal dropping (Fig. 1b). The detailed method is that the assigner first calculates the supporting UMI number to every CB, and sorts the CB list by UMI number in decreasing order. Following by computing the partial derivatives (slopes) per CB in log10 scale, the medium number of slope changes in log10 scale are computed per 0.001 log10 tick. Then the maximal medium log10 slope change is selected, and where is the crude anchoring for following processes. To fathom the fully signal dropping point and include more useful CBs, we allow 10% more signal in log10 scale. Next, the script collapses CBs which have similar sequences. Previous study shows that the most accurate criterial for CB and UMI collapsing in Illumina samples are three and two Levenshtein Distance (LD), respectively. Here we use one LD to merge similar CB as Refinery Local Optimization. Then a list of representative CB having sufficient supporting read is generated. Alternatively, you can forcely assign cell barcode number by using "forced_no" parameter.
-
Manual of assigner.py
python3 assigner.py -h Usage: assigner.py [options] Options: -h, --help show this help message and exit -i INPUT Cell barcode list file. Could be either in .tsv or .tsv.gz format. Default: barcode_list.tsv.gz -o OUTPUT Cell barcode counting file name. Default: CB_counting.tsv.gz -d O_DIR Output directory name. Default: scNanoGPS_res --tmp_dir=TMP_DIR Temporary folder name. Default: tmp -t NCORES Number of cores for program running. Default: 1 --log=LOG_F_NAME Log file name. Default: assigner.log.txt --lCB=BC_LEN Length of cell barcode. Default: 16 --CB_no_ext=CB_NO_EXT Increasing CB number on log scale. Default: 0.1 --CB_log10_dist_o=CB_LOG10_DIST_O File name used for plotting log10 UMI number distribution. Default: CB_log10_dist.png --CB_mrg_thr=CB_MRG_THR Threshold of distance for merging cell barcodes. Default: 1 --CB_mrg_dist=CB_MRG_DIST File name for distance matrix of merging cell barcodes. Default: CB_merged_dist.tsv.gz --CB_mrg_o=CB_MRG_O File name for merged cell barcodes. Default: CB_merged_list.tsv.gz --forced_no=FORCED_NO Assign cell number in force. If this parameter is assigned, the raw CB with given number will be outputed without correction. Default: 0 --min_cellno=MIN_CELLNO Minimal cell number. Default: 1 --smooth_res=SMOOTH_RES Smoothening resolution on log10 scale. Default: 0.001
-
Example code:
python3 assigner.py -t 2 # To generate raw matrix similar to 10X for SoupX, you can try forcedly assign cell number to 20000 python3 assigner.py -t 2 --forced_no 20000
This step of scNanoGPS pipeline is executed by a python script called “curator.py”. This script is used for demultiplexing, filtering, reference genome mapping and re-mapping, and UMI collapsing.
The master FastQ file of all cells is demultiplexed according to the true CB list determined by Assigner into single cell FastQ files each representing one cell. Curator then maps individual FastQ files onto given reference genome by Mimimap2 under splice mode. Chimeric reads from different chromosomes are filtered out in this step (fusion gene detection functionality is under development). Next, Curator scans UMIs through their full length reads by their mapped genomic orders. UMIs that within 2 LD and mapping to same genomic coordinates are considered as same UMI barcodes. To further accommodate possible small indels (<5bp) that causes minor drifting of mapping coordinates, Curator allows 5bp differences to buffer these sequencing errors. To perform parallel computing, the reads scanning is placed into batches based on their genomic coordinates. The reads that share same UMIs are collapsed to generate consensus sequences of individual molecules using software, SPOA. Finally, we re-map the consensus sequences of single cells onto reference genome by using Minimap2 under splice mode. There is a portion of reads that are singletons having only one UMI, which is mapped previsouly. We merged both singleton BAMs with consensus BAMs to formal a final BAMs as curated data.
-
Manual of curator.py
python3 curator.py -h Usage: curator.py [options] Options: -h, --help show this help message and exit --fq_name=FQ_NAME Processed fastq file name. Default: processed.fastq.gz -b BC_LIST Output cell barcode list file. Default: barcode_list.tsv.gz --CB_count=CB_COUNT Cell barcode counting file name. Default: CB_counting.tsv.gz --CB_list=CB_LIST File name for merged cell barcodes. Default: CB_merged_list.tsv.gz --ref_genome=REF_GENOME * Required ! File for reference genome. --idx_genome=IDX_GENOME Path to the Minimap2 genome index. Program will use reference genome if no Minimap2 genome index given. Default: None -d O_DIR Output directory name. Default: scNanoGPS_res --tmp_dir=TMP_DIR Temporary folder name. Default: tmp -t NCORES Number of cores for computing. Default: 1 --log=LOG_F_NAME Log file name. Default: curator.log.txt --umi_ld=UMI_LD Levenshtein distance for merging UMI. Default: 1 --keep_meta=KEEP_META Set it to 1 to keep meta data, e.g. sam files, for futher checking. Default: None --inc_bed=INC_BED Include specific regions (BED) in file. Default: None --exc_bed=EXC_BED Exclude specific regions (BED) in file. Default: None --softclipping_thr=SOFTCLIPPING_THR Threshold for softclipping. Default: 0.8 --minimap2=MINIMAP2 Path to minimap2. Default: minimap2 --samtools=SAMTOOLS Path to samtools. Default: samtools --spoa=SPOA Path to spoa. Default: spoa --skip_curation=SKIP_CURATION Set to 1 to skip UMI collaping and consensus sequence generating. Default: None
-
Example code:
python3 curator.py -t 2 --ref_genome example/GRCh38_chr22.fa.gz --idx_genome example/GRCh38_chr22.mmi # To generate raw matrix similar to 10X for SoupX, you can generate data by skipping curation python3 curator.py -t 2 --ref_genome example/GRCh38_chr22.fa.gz --idx_genome example/GRCh38_chr22.mmi --skip_curation 1
Lastly, scNanoGPS contains a set of reporter scripts for generating multi-omics profiles from same single cells with Nanopore long-read sequencing data. This version of scNanoGPS detects the gene expression, isoform, and single nucleotide variations (SNVs) profiles by using FeatureCounts, LIQA, and longshot, respectively.
-
Manual of reporter_expression.py
python3 reporter_expression.py -h Usage: reporter_expression.py [options] Options: -h, --help show this help message and exit -d O_DIR Output directory name. Default: scNanoGPS_res --tmp_dir=TMP_DIR Temporary folder name. Default: tmp --gtf=GTF * Required ! GTF file for expression calling. -o O_NAME Counting table name. Default: matrix.tsv --log=LOG_F_NAME Log file name.Default: reporter_expression.log.txt -t NCORES Number of cores for program running. Default: 1 --min_gene_no=MIN_GENE_NO Minimal number of gene per cell. Default: 300 --sel_bc_o=SEL_BC_O Filtered cell barcode list. Default: filtered_barcode_list.txt --featurecounts=FEATURECOUNTS Path to featureCounts.Default: featureCounts
-
Example code:
# Please add featureCounts into your path to use which command python3 reporter_expression.py -t 2 --gtf example/GRCh38_chr22.gtf --featurecounts $(which featureCounts) # or python3 reporter_expression.py -t 2 --gtf example/GRCh38_chr22.gtf --featurecounts /path/to/subread_folder/bin/featureCounts # Please add "min_gene_no 1" for test because the example fastq is a subset pool and contains only a dozen of genes. python3 reporter_expression.py -t 2 --gtf example/GRCh38_chr22.gtf --min_gene_no 1 --featurecounts $(which featureCounts)
-
Manual of reporter_isoform.py
python3 reporter_isoform.py -h Usage: reporter_isoform.py [options] Options: -h, --help show this help message and exit -d O_DIR Output directory name. Default: scNanoGPS_res --tmp_dir=TMP_DIR Temporary folder name. Default: tmp --CB_file=CB_FILE File name for filtered barcode list. Default: filtered_barcode_list.txt --gtf=GTF GTF file for obtaining transcript ID. --liqa_ref=LIQA_REF * Required ! Reference of LIQA. -o O_NAME Counting table name. Default: matrix_isoform.tsv --log=LOG_F_NAME Log file name. Default: reporter_isoform.log.txt -t NCORES Number of cores for program running. Default: 1 --liqa=LIQA Program name of LIQA. Default: liqa --liqa_log=LIQA_LOG Suffix of LIQA output file. Default: .liqa.log --liqa_o=LIQA_O Suffix of LIQA output file. Default: .liqa.tsv
-
Example code:
# Please add liqa into your path to use which command python3 reporter_isoform.py -t 2 --liqa_ref example/GRCh38_chr22.liqa.refgene # or python3 reporter_isoform.py -t 2 --liqa $(which liqa) --liqa_ref example/GRCh38_chr22.liqa.refgene # or python3 reporter_isoform.py -t 2 --liqa /path/to/liqa --liqa_ref example/GRCh38_chr22.liqa.refgene
-
Manual of reporter_SNV.py
python3 reporter_SNV.py -h Usage: reporter_SNV.py [options] Options: -h, --help show this help message and exit -d O_DIR Output directory name. Default: scNanoGPS_res --tmp_dir=TMP_DIR Temporary folder name. Default: tmp --CB_file=CB_FILE File name for filtered barcode list. Default: filtered_barcode_list.txt --ref_genome=REF_GENOME * Required ! File for reference genome. --longshot_min_cov=LONGSHOT_MIN_COV Minimal coverage for longshot. Default: 2 --longshot_min_alt_count=LONGSHOT_MIN_ALT_COUNT Minimal alternative count for longshot. Default: 2 --longshot_o=LONGSHOT_O Prefix of LongShot output VCF file. Default: longshot.output -o O_NAME Result SNV matrix file name. Must be ended with .vcf.gz. Default: matrix_SNV.vcf.gz --log=LOG_F_NAME Log file name. Default: reporter_SNV.log.txt --o_snv_l=O_SNV_L Filtered SNVs position list. Default: filtered_SNV_position_list.tsv.gz --o_snv_dp=O_SNV_DP SNVs depth matrix. Default: matrix_SNV_dp.tsv.gz -t NCORES Number of cores for program running. Default: 1 --samtools=SAMTOOLS Path to samtools. Default: samtools --bcftools=BCFTOOLS Path to bcftools. Default: bcftools --tabix=TABIX Path to tabix. Default: tabix --longshot=LONGSHOT Path to longshot. Default: None --prevalence=PREVALENCE SNV prevalence rate. Default: 0.01 --min_read_quality=MIN_READ_QUALITY Minimal read quality. Default: 0 --annovar=ANNOVAR Path to Annovar. Default: None --annovar_db=ANNOVAR_DB Path to Annovar database. Default: None --annovar_gv=ANNOVAR_GV Annovar database genome version. Default: hg38 --annovar_protocol=ANNOVAR_PROTOCOL Protocols of Annovar database. Default: refGene,cytoBand,gnomad30_genome,avsnp150,dbnsfp42c --annovar_operation=ANNOVAR_OPERATION Operation of Annovar database. Default: gx,r,f,f,f --annovar_xref=ANNOVAR_XREF Path to Omim xref. Default: None --keep_meta=KEEP_META Keep meta files. Default: None
-
Example code for variant detection with LongShot and annotation with ANNOVAR (please make sure to include ANNOVAR in your path):
# Please add annovar into your path to use which command python3 reporter_SNV.py -t 2 --ref_genome example/GRCh38_chr22.fa.gz --annovar $(which table_annovar.pl) --annovar_db path/to/annovar_db/ # or python3 reporter_SNV.py -t 2 --ref_genome example/GRCh38_chr22.fa.gz --annovar /path/to/annovar/table_annovar.pl --annovar_db path/to/annovar_db/
-
Example code for variant calling without ANNOVAR annotations (optional, not suggested):
python3 reporter_SNV.py -t 2 --ref_genome example/GRCh38_chr22.fa.gz
-
Manual of reporter_summary.py
python3 reporter_summary.py -h Usage: reporter_summary.py [options] Options: -h, --help show this help message and exit -d O_DIR Output directory name. Default: scNanoGPS_res --tmp_dir=TMP_DIR Temporary folder name. Default: tmp --scanner_log=SCANNER_LOG Scanner log file name. Default: scanner.log.txt --bc_f=BC_F Cell barcode list file. Default: barcode_list.tsv.gz --read_len_f=READ_LEN_F Scanner log file name. Default: read_length.tsv.gz --CB_file=CB_FILE File name for filtered barcode list. Default: filtered_barcode_list.txt --exp_tb=EXP_TB Counting table name. Default: matrix.tsv --ref_genome=REF_GENOME * Required ! File for reference genome. --gtf=GTF * Required ! Genome annotation file GTF. --log=LOG_F_NAME Log file name. Default: summary.txt --samtools=SAMTOOLS Path to samtools. Default: samtools --qualimap=QUALIMAP Path to qualimap. Default: qualimap
-
Example code for generating final summary
python3 reporter_summary.py --ref_genome example/GRCh38_chr22.fa.gz --gtf example/GRCh38_chr22.gtf
-
Example summary table
Read yield: 98349656 Valid read number: 76630302 Detecting rate: 77.92% Median read length: 921.0 Mean read length: 1146.76 Maximal read length: 190885 Median read quality: 21.12 Mean read quality: 20.47 Cell number: 3470 Raw reads per cell: 28342.84 UMI counts: 27292859 Mean UMI counts per cell: 7865.38 Median UMI counts per cell: 5212.5 Exonic: 13.91% Intronic: 70.2% Intergenic: 15.89%