fix: fix exon/intron boundary determining process

src/varity/vcf_to_hgvs/protein.clj

@@ -24,7 +24,8 @@
               :else :same)
         tpos (+ pos (min nref nalt))
         d (Math/abs (- nref nalt))]
-    (when (and (not= 1 nref) (not= 1 nalt)
+    (when (and (not (= 1 nref nalt))
+               (not= 1 (count exon-ranges))
                (some (fn [[s e]]
                        (and (not= s e)
                             (or (and (< pos s) (<= s (+ pos nref -1)))

test/varity/vcf_to_hgvs/protein_test.clj

@@ -15,15 +15,16 @@
     2 "XX" "X" [[2 3] [7 10]]
     3 "XX" "X" [[2 3] [7 10]]
     6 "XX" "X" [[2 4] [7 10]]
-    6 "XXX" "X" [[2 4] [7 9]]
-    3 "XXX" "X" [[2 3] [6 9]]
-    1 "XXXXX" "X" [[4 7]]
     9 "XXX" "XXX" [[2 4] [8 11]])
-  ;; Can't determine whether the splice site is shifted or not
-  (is (thrown-with-msg?
-       Exception
-       #"unsupported"
-       (#'prot/alt-exon-ranges [[2 4] [8 11]] 3 "XXX" "XXX"))))
+  ;; Variants overlapping a boundary of exon/intron
+  (are [p r a] (thrown-with-msg?
+                Exception
+                #"unsupported"
+                (#'prot/alt-exon-ranges [[2 4] [8 11]] p r a))
+    3 "XXX" "XXX"
+    6 "XXX" "X"
+    3 "XXX" "X"
+    1 "XXXXX" "X"))
 
 (deftest exon-sequence-test
   ;; A  C G T  A C G  T A C  G   T  A  C  G

test/varity/vcf_to_hgvs_test.clj

@@ -195,8 +195,6 @@
         "chr7" 152247986 "G" "GT" '("p.Y816*") ; cf. rs150073007 (-, nonsense mutation)
         "chr17" 31159027 "TGC" "T" '("p.A75*") ; not actual example (+, nonsense in del case)
         "chr2" 47478341 "TG" "T" '("p.L762*" "p.L696*") ;; rs786204050 (+) frameshift with termination
-        "chr8" 42838217 "GAGATTAACAGGGGTCTGAAGAGGCGGCATTAGTAATCCAATAGCAGCATCAACCTGGGAAACAGGAGGCGGTAAAGGAGGTGGGGGAAGCTGTTCCTGTGGCTCCAGAAGATCTTCTTTCTAAAACAAAAATACAAAGTATGTTTGAATTTAGTAACTAAAAACAGTTTAAA" "G"
-        '("p.K90Lfs*5" "p.K25*") ; cf. VCV000965170.1 (-, frameshift with termination)
         "chr17" 7676202 "T" "TGTCCCTTAGTCTT" '("p.P58*" "p.P19*") ; cf. not actual example (-, frameshift with termination)
 
         ;; deletion
@@ -232,10 +230,6 @@
                                           "p.S1415Ifs*2") ; https://github.com/chrovis/varity/issues/58
         "chr17" 31261816 "CC" "C" '("p.N1542Tfs*11" "p.N1563Tfs*11") ; cf. rs1555619041 (+)
 
-        ;; frame shift with initiation codon change (e.g. NM_007298:c.-19_80del from BRCA Share)
-        "chr17" 43124016 "CCAGATGGGACACTCTAAGATTTTCTGCATAGCATTAATGACATTTTGTACTTCTTCAACGCGAAGAGCAGATAAATCCATTTCTTTCTGTTCCAATGAA" "C"
-        '("p.M1Sfs*13")
-
         ;; Extension
         "chr2" 188974490 "A" "C" '("p.M1Lext-23")
         "chr2" 189011772 "T" "C" '("p.*1467Qext*45") ; cf. ClinVar 101338
@@ -300,7 +294,15 @@
         ;; The intron in between remains unchanged.
         "chr1" 26773714
         "AACGGTGAGTAAAGCCTGGTCTCGGTGCTGCTATGGATCAGGCTTCGCCACTGCCCACCCTAATCCTGTGTTTCTTTGCCTCCTATAGACAT"
-        "AGCAACGGTGAGTAAAGCCTGGTCTCGGTGCTGCTATGGATCAGGCTTCGCCACTGCCCACCCTAATCCTGTGTTTCTTTGCCTCCTATAGACATCAT"))))
+        "AGCAACGGTGAGTAAAGCCTGGTCTCGGTGCTGCTATGGATCAGGCTTCGCCACTGCCCACCCTAATCCTGTGTTTCTTTGCCTCCTATAGACATCAT"
+
+        ;; Variants include exon/intron boundary.
+        ;; cf. VCV000965170.1
+        "chr8" 42838217 "GAGATTAACAGGGGTCTGAAGAGGCGGCATTAGTAATCCAATAGCAGCATCAACCTGGGAAACAGGAGGCGGTAAAGGAGGTGGGGGAAGCTGTTCCTGTGGCTCCAGAAGATCTTCTTTCTAAAACAAAAATACAAAGTATGTTTGAATTTAGTAACTAAAAACAGTTTAAA" "G"
+        ;; e.g. NM_007298:c.-19_80del from BRCA Share
+        "chr17" 43124016 "CCAGATGGGACACTCTAAGATTTTCTGCATAGCATTAATGACATTTTGTACTTCTTCAACGCGAAGAGCAGATAAATCCATTTCTTTCTGTTCCAATGAA" "C"
+        ;; e.g. NM_001174080:c.3696-10_3710del
+        "chr19" 13283381 "GCACAGGCGGCGAAGGCTGTTGGAGA" "G"))))
 
 (deftest coding-dna-ref-gene?-test
   (testing "valid reference genes"