From bc788fc614be58881147fd732e0798d9f30dfc90 Mon Sep 17 00:00:00 2001 From: Danilo Di Leo Date: Tue, 23 Jul 2024 13:39:18 +0200 Subject: [PATCH 1/3] modules update --- modules.json | 32 +- modules/nf-core/cat/cat/main.nf | 1 - modules/nf-core/cat/cat/tests/main.nf.test | 27 +- .../nf-core/cat/cat/tests/main.nf.test.snap | 74 ++-- modules/nf-core/cat/fastq/main.nf | 10 +- modules/nf-core/cat/fastq/tests/main.nf.test | 136 ++++++- .../nf-core/cat/fastq/tests/main.nf.test.snap | 207 ++++++++++ modules/nf-core/fastqc/tests/main.nf.test | 225 ++++++++--- .../nf-core/fastqc/tests/main.nf.test.snap | 370 ++++++++++++++++-- modules/nf-core/gunzip/environment.yml | 4 +- modules/nf-core/gunzip/main.nf | 17 +- modules/nf-core/gunzip/meta.yml | 1 + modules/nf-core/gunzip/tests/main.nf.test | 85 ++++ .../nf-core/gunzip/tests/main.nf.test.snap | 103 +++++ modules/nf-core/gunzip/tests/nextflow.config | 5 + modules/nf-core/multiqc/environment.yml | 2 +- modules/nf-core/multiqc/main.nf | 10 +- modules/nf-core/multiqc/meta.yml | 13 + modules/nf-core/multiqc/tests/main.nf.test | 6 + .../nf-core/multiqc/tests/main.nf.test.snap | 12 +- .../samtools/flagstat/tests/main.nf.test | 28 +- .../samtools/flagstat/tests/main.nf.test.snap | 78 +++- .../nf-core/samtools/idxstats/environment.yml | 4 +- modules/nf-core/samtools/idxstats/main.nf | 4 +- .../samtools/idxstats/tests/main.nf.test | 29 +- .../samtools/idxstats/tests/main.nf.test.snap | 78 +++- modules/nf-core/samtools/index/main.nf | 7 +- .../nf-core/samtools/index/tests/main.nf.test | 87 +++- .../samtools/index/tests/main.nf.test.snap | 264 ++++++++++--- modules/nf-core/samtools/sort/environment.yml | 4 +- modules/nf-core/samtools/sort/main.nf | 18 +- .../nf-core/samtools/sort/tests/main.nf.test | 52 ++- .../samtools/sort/tests/main.nf.test.snap | 144 ++++--- .../samtools/sort/tests/nextflow_cram.config | 8 + .../nf-core/samtools/stats/environment.yml | 4 +- modules/nf-core/samtools/stats/main.nf | 4 +- .../nf-core/samtools/stats/tests/main.nf.test | 57 ++- .../samtools/stats/tests/main.nf.test.snap | 98 ++++- modules/nf-core/sourmash/index/main.nf | 14 +- modules/nf-core/sourmash/index/meta.yml | 6 +- .../nf-core/sourmash/index/tests/main.nf.test | 71 ++++ .../sourmash/index/tests/main.nf.test.snap | 50 +++ modules/nf-core/sourmash/index/tests/tags.yml | 2 + modules/nf-core/subread/featurecounts/main.nf | 12 + .../subread/featurecounts/tests/main.nf.test | 78 +++- .../featurecounts/tests/main.nf.test.snap | 207 ++++++++++ modules/nf-core/trimgalore/main.nf | 21 + modules/nf-core/trimgalore/tests/main.nf.test | 47 +++ .../trimgalore/tests/main.nf.test.snap | 154 ++++++++ modules/nf-core/untar/environment.yml | 4 +- modules/nf-core/untar/main.nf | 29 +- modules/nf-core/untar/tests/main.nf.test | 44 ++- modules/nf-core/untar/tests/main.nf.test.snap | 152 ++++++- .../tests/main.nf.test | 76 +++- .../tests/main.nf.test.snap | 326 ++++++++++++--- .../bam_stats_samtools/tests/main.nf.test | 116 +++++- .../tests/main.nf.test.snap | 336 ++++++++++++---- 57 files changed, 3473 insertions(+), 580 deletions(-) create mode 100644 modules/nf-core/gunzip/tests/nextflow.config create mode 100644 modules/nf-core/samtools/sort/tests/nextflow_cram.config create mode 100644 modules/nf-core/sourmash/index/tests/main.nf.test create mode 100644 modules/nf-core/sourmash/index/tests/main.nf.test.snap create mode 100644 modules/nf-core/sourmash/index/tests/tags.yml diff --git a/modules.json b/modules.json index 1b7a99e..d54d688 100644 --- a/modules.json +++ b/modules.json @@ -27,12 +27,12 @@ }, "cat/cat": { "branch": "master", - "git_sha": "9437e6053dccf4aafa022bfd6e7e9de67e625af8", + "git_sha": "5bb8ca085e17549e185e1823495ab8d20727a805", "installed_by": ["modules"] }, "cat/fastq": { "branch": "master", - "git_sha": "4fc983ad0b30e6e32696fa7d980c76c7bfe1c03e", + "git_sha": "1ceaa8ba4d0fd886dbca0e545815d905b7407de7", "installed_by": ["modules"] }, "checkm/lineagewf": { @@ -52,7 +52,7 @@ }, "fastqc": { "branch": "master", - "git_sha": "285a50500f9e02578d90b3ce6382ea3c30216acd", + "git_sha": "46eca555142d6e597729fcb682adcc791796f514", "installed_by": ["modules"] }, "gtdbtk/classifywf": { @@ -62,12 +62,12 @@ }, "gunzip": { "branch": "master", - "git_sha": "3a5fef109d113b4997c9822198664ca5f2716208", + "git_sha": "4e5f4687318f24ba944a13609d3ea6ebd890737d", "installed_by": ["modules"] }, "multiqc": { "branch": "master", - "git_sha": "8f2062e7b4185590fb9f43c275381a31a6544fc0", + "git_sha": "b80f5fd12ff7c43938f424dd76392a2704fa2396", "installed_by": ["modules"] }, "prokka": { @@ -77,27 +77,27 @@ }, "samtools/flagstat": { "branch": "master", - "git_sha": "04fbbc7c43cebc0b95d5b126f6d9fe4effa33519", + "git_sha": "46eca555142d6e597729fcb682adcc791796f514", "installed_by": ["bam_stats_samtools"] }, "samtools/idxstats": { "branch": "master", - "git_sha": "f4596fe0bdc096cf53ec4497e83defdb3a94ff62", + "git_sha": "46eca555142d6e597729fcb682adcc791796f514", "installed_by": ["bam_stats_samtools"] }, "samtools/index": { "branch": "master", - "git_sha": "04fbbc7c43cebc0b95d5b126f6d9fe4effa33519", + "git_sha": "46eca555142d6e597729fcb682adcc791796f514", "installed_by": ["bam_sort_stats_samtools"] }, "samtools/sort": { "branch": "master", - "git_sha": "4352dbdb09ec40db71e9b172b97a01dcf5622c26", + "git_sha": "46eca555142d6e597729fcb682adcc791796f514", "installed_by": ["bam_sort_stats_samtools"] }, "samtools/stats": { "branch": "master", - "git_sha": "f4596fe0bdc096cf53ec4497e83defdb3a94ff62", + "git_sha": "46eca555142d6e597729fcb682adcc791796f514", "installed_by": ["bam_stats_samtools"] }, "sourmash/gather": { @@ -107,7 +107,7 @@ }, "sourmash/index": { "branch": "master", - "git_sha": "3f5420aa22e00bd030a2556dfdffc9e164ec0ec5", + "git_sha": "1c1bd04e617b2b6b50c48cb7c3f2fba039903a83", "installed_by": ["modules"] }, "sourmash/sketch": { @@ -117,17 +117,17 @@ }, "subread/featurecounts": { "branch": "master", - "git_sha": "e5265c217dcfbff7731c40623aaf07538fdd3e1c", + "git_sha": "b4919e9a2b4d8b71061e601633db4600a3858fa1", "installed_by": ["modules"] }, "trimgalore": { "branch": "master", - "git_sha": "a98418419ae6c9df3cf6cf108d1e1aba71037d5a", + "git_sha": "b4919e9a2b4d8b71061e601633db4600a3858fa1", "installed_by": ["modules"] }, "untar": { "branch": "master", - "git_sha": "5caf7640a9ef1d18d765d55339be751bb0969dfa", + "git_sha": "4e5f4687318f24ba944a13609d3ea6ebd890737d", "installed_by": ["modules"] } } @@ -136,12 +136,12 @@ "nf-core": { "bam_sort_stats_samtools": { "branch": "master", - "git_sha": "04fbbc7c43cebc0b95d5b126f6d9fe4effa33519", + "git_sha": "46eca555142d6e597729fcb682adcc791796f514", "installed_by": ["subworkflows"] }, "bam_stats_samtools": { "branch": "master", - "git_sha": "04fbbc7c43cebc0b95d5b126f6d9fe4effa33519", + "git_sha": "0eacd714effe5aac1c1de26593873960b3346cab", "installed_by": ["bam_sort_stats_samtools", "subworkflows"] }, "utils_nextflow_pipeline": { diff --git a/modules/nf-core/cat/cat/main.nf b/modules/nf-core/cat/cat/main.nf index adbdbd7..2862c64 100644 --- a/modules/nf-core/cat/cat/main.nf +++ b/modules/nf-core/cat/cat/main.nf @@ -76,4 +76,3 @@ def getFileSuffix(filename) { def match = filename =~ /^.*?((\.\w{1,5})?(\.\w{1,5}\.gz$))/ return match ? match[0][1] : filename.substring(filename.lastIndexOf('.')) } - diff --git a/modules/nf-core/cat/cat/tests/main.nf.test b/modules/nf-core/cat/cat/tests/main.nf.test index fcee2d1..9cb1617 100644 --- a/modules/nf-core/cat/cat/tests/main.nf.test +++ b/modules/nf-core/cat/cat/tests/main.nf.test @@ -29,7 +29,8 @@ nextflow_process { then { assertAll( { assert !process.success }, - { assert process.stdout.toString().contains("The name of the input file can't be the same as for the output prefix") } + { assert process.stdout.toString().contains("The name of the input file can't be the same as for the output prefix") }, + { assert snapshot(process.out.versions).match() } ) } } @@ -83,8 +84,12 @@ nextflow_process { def lines = path(process.out.file_out.get(0).get(1)).linesGzip assertAll( { assert process.success }, - { assert snapshot(lines[0..5]).match("test_cat_zipped_zipped_lines") }, - { assert snapshot(lines.size()).match("test_cat_zipped_zipped_size")} + { assert snapshot( + lines[0..5], + lines.size(), + process.out.versions + ).match() + } ) } } @@ -142,8 +147,12 @@ nextflow_process { def lines = path(process.out.file_out.get(0).get(1)).linesGzip assertAll( { assert process.success }, - { assert snapshot(lines[0..5]).match("test_cat_unzipped_zipped_lines") }, - { assert snapshot(lines.size()).match("test_cat_unzipped_zipped_size")} + { assert snapshot( + lines[0..5], + lines.size(), + process.out.versions + ).match() + } ) } } @@ -170,8 +179,12 @@ nextflow_process { def lines = path(process.out.file_out.get(0).get(1)).linesGzip assertAll( { assert process.success }, - { assert snapshot(lines[0..5]).match("test_cat_one_file_unzipped_zipped_lines") }, - { assert snapshot(lines.size()).match("test_cat_one_file_unzipped_zipped_size")} + { assert snapshot( + lines[0..5], + lines.size(), + process.out.versions + ).match() + } ) } } diff --git a/modules/nf-core/cat/cat/tests/main.nf.test.snap b/modules/nf-core/cat/cat/tests/main.nf.test.snap index 423571b..b7623ee 100644 --- a/modules/nf-core/cat/cat/tests/main.nf.test.snap +++ b/modules/nf-core/cat/cat/tests/main.nf.test.snap @@ -1,10 +1,4 @@ { - "test_cat_unzipped_zipped_size": { - "content": [ - 375 - ], - "timestamp": "2023-10-16T14:33:08.049445686" - }, "test_cat_unzipped_unzipped": { "content": [ { @@ -34,6 +28,10 @@ ] } ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.3" + }, "timestamp": "2023-10-16T14:32:18.500464399" }, "test_cat_zipped_unzipped": { @@ -65,9 +63,13 @@ ] } ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.3" + }, "timestamp": "2023-10-16T14:32:49.642741302" }, - "test_cat_zipped_zipped_lines": { + "test_cat_zipped_zipped": { "content": [ [ "MT192765.1\tGenbank\ttranscript\t259\t29667\t.\t+\t.\tID=unknown_transcript_1;geneID=orf1ab;gene_name=orf1ab", @@ -76,11 +78,31 @@ "MT192765.1\tGenbank\tCDS\t13461\t21548\t.\t+\t0\tParent=unknown_transcript_1;exception=\"ribosomal slippage\";gbkey=CDS;gene=orf1ab;note=\"pp1ab;translated=by -1 ribosomal frameshift\";product=\"orf1ab polyprotein\";protein_id=QIK50426.1", "MT192765.1\tGenbank\tCDS\t21556\t25377\t.\t+\t0\tParent=unknown_transcript_1;gbkey=CDS;gene=S;note=\"structural protein\";product=\"surface glycoprotein\";protein_id=QIK50427.1", "MT192765.1\tGenbank\tgene\t21556\t25377\t.\t+\t.\tParent=unknown_transcript_1" + ], + 78, + [ + "versions.yml:md5,115ed6177ebcff24eb99d503fa5ef894" + ] + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T11:51:46.802978" + }, + "test_cat_name_conflict": { + "content": [ + [ + ] ], - "timestamp": "2023-10-16T14:32:33.629048645" + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T11:51:29.45394" }, - "test_cat_unzipped_zipped_lines": { + "test_cat_one_file_unzipped_zipped": { "content": [ [ ">MT192765.1 Severe acute respiratory syndrome coronavirus 2 isolate SARS-CoV-2/human/USA/PC00101P/2020, complete genome", @@ -89,11 +111,19 @@ "TAACTCGTCTATCTTCTGCAGGCTGCTTACGGTTTCGTCCGTGTTGCAGCCGATCATCAGCACATCTAGGTTTTGTCCGG", "GTGTGACCGAAAGGTAAGATGGAGAGCCTTGTCCCTGGTTTCAACGAGAAAACACACGTCCAACTCAGTTTGCCTGTTTT", "ACAGGTTCGCGACGTGCTCGTACGTGGCTTTGGAGACTCCGTGGAGGAGGTCTTATCAGAGGCACGTCAACATCTTAAAG" + ], + 374, + [ + "versions.yml:md5,115ed6177ebcff24eb99d503fa5ef894" ] ], - "timestamp": "2023-10-16T14:33:08.038830506" + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T11:52:02.774016" }, - "test_cat_one_file_unzipped_zipped_lines": { + "test_cat_unzipped_zipped": { "content": [ [ ">MT192765.1 Severe acute respiratory syndrome coronavirus 2 isolate SARS-CoV-2/human/USA/PC00101P/2020, complete genome", @@ -102,20 +132,16 @@ "TAACTCGTCTATCTTCTGCAGGCTGCTTACGGTTTCGTCCGTGTTGCAGCCGATCATCAGCACATCTAGGTTTTGTCCGG", "GTGTGACCGAAAGGTAAGATGGAGAGCCTTGTCCCTGGTTTCAACGAGAAAACACACGTCCAACTCAGTTTGCCTGTTTT", "ACAGGTTCGCGACGTGCTCGTACGTGGCTTTGGAGACTCCGTGGAGGAGGTCTTATCAGAGGCACGTCAACATCTTAAAG" + ], + 375, + [ + "versions.yml:md5,115ed6177ebcff24eb99d503fa5ef894" ] ], - "timestamp": "2023-10-16T14:33:21.39642399" - }, - "test_cat_zipped_zipped_size": { - "content": [ - 78 - ], - "timestamp": "2023-10-16T14:32:33.641869244" - }, - "test_cat_one_file_unzipped_zipped_size": { - "content": [ - 374 - ], - "timestamp": "2023-10-16T14:33:21.4094373" + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T11:51:57.581523" } } \ No newline at end of file diff --git a/modules/nf-core/cat/fastq/main.nf b/modules/nf-core/cat/fastq/main.nf index f132b2a..b68e5f9 100644 --- a/modules/nf-core/cat/fastq/main.nf +++ b/modules/nf-core/cat/fastq/main.nf @@ -53,9 +53,9 @@ process CAT_FASTQ { def prefix = task.ext.prefix ?: "${meta.id}" def readList = reads instanceof List ? reads.collect{ it.toString() } : [reads.toString()] if (meta.single_end) { - if (readList.size > 1) { + if (readList.size >= 1) { """ - touch ${prefix}.merged.fastq.gz + echo '' | gzip > ${prefix}.merged.fastq.gz cat <<-END_VERSIONS > versions.yml "${task.process}": @@ -64,10 +64,10 @@ process CAT_FASTQ { """ } } else { - if (readList.size > 2) { + if (readList.size >= 2) { """ - touch ${prefix}_1.merged.fastq.gz - touch ${prefix}_2.merged.fastq.gz + echo '' | gzip > ${prefix}_1.merged.fastq.gz + echo '' | gzip > ${prefix}_2.merged.fastq.gz cat <<-END_VERSIONS > versions.yml "${task.process}": diff --git a/modules/nf-core/cat/fastq/tests/main.nf.test b/modules/nf-core/cat/fastq/tests/main.nf.test index a71dcb8..f88a78b 100644 --- a/modules/nf-core/cat/fastq/tests/main.nf.test +++ b/modules/nf-core/cat/fastq/tests/main.nf.test @@ -13,9 +13,6 @@ nextflow_process { test("test_cat_fastq_single_end") { when { - params { - outdir = "$outputDir" - } process { """ input[0] = Channel.of([ @@ -38,9 +35,6 @@ nextflow_process { test("test_cat_fastq_paired_end") { when { - params { - outdir = "$outputDir" - } process { """ input[0] = Channel.of([ @@ -65,9 +59,6 @@ nextflow_process { test("test_cat_fastq_single_end_same_name") { when { - params { - outdir = "$outputDir" - } process { """ input[0] = Channel.of([ @@ -90,9 +81,6 @@ nextflow_process { test("test_cat_fastq_paired_end_same_name") { when { - params { - outdir = "$outputDir" - } process { """ input[0] = Channel.of([ @@ -117,9 +105,129 @@ nextflow_process { test("test_cat_fastq_single_end_single_file") { when { - params { - outdir = "$outputDir" + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:true ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true)] + ]) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("test_cat_fastq_single_end - stub") { + + options "-stub" + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:true ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)] + ]) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("test_cat_fastq_paired_end - stub") { + + options "-stub" + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test2_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test2_2.fastq.gz', checkIfExists: true)] + ]) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("test_cat_fastq_single_end_same_name - stub") { + + options "-stub" + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:true ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true)] + ]) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("test_cat_fastq_paired_end_same_name - stub") { + + options "-stub" + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true)] + ]) + """ } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("test_cat_fastq_single_end_single_file - stub") { + + options "-stub" + + when { process { """ input[0] = Channel.of([ diff --git a/modules/nf-core/cat/fastq/tests/main.nf.test.snap b/modules/nf-core/cat/fastq/tests/main.nf.test.snap index 43dfe28..aec119a 100644 --- a/modules/nf-core/cat/fastq/tests/main.nf.test.snap +++ b/modules/nf-core/cat/fastq/tests/main.nf.test.snap @@ -28,6 +28,10 @@ ] } ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, "timestamp": "2024-01-17T17:30:39.816981" }, "test_cat_fastq_single_end_same_name": { @@ -59,6 +63,10 @@ ] } ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, "timestamp": "2024-01-17T17:32:35.229332" }, "test_cat_fastq_single_end_single_file": { @@ -90,6 +98,10 @@ ] } ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, "timestamp": "2024-01-17T17:34:00.058829" }, "test_cat_fastq_paired_end_same_name": { @@ -127,8 +139,123 @@ ] } ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, "timestamp": "2024-01-17T17:33:33.031555" }, + "test_cat_fastq_single_end - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": true + }, + "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ], + "1": [ + "versions.yml:md5,d42d6e24d67004608495883e00bd501b" + ], + "reads": [ + [ + { + "id": "test", + "single_end": true + }, + "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ], + "versions": [ + "versions.yml:md5,d42d6e24d67004608495883e00bd501b" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-07-05T12:07:28.244999" + }, + "test_cat_fastq_paired_end_same_name - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test_2.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] + ], + "1": [ + "versions.yml:md5,d42d6e24d67004608495883e00bd501b" + ], + "reads": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test_2.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] + ], + "versions": [ + "versions.yml:md5,d42d6e24d67004608495883e00bd501b" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-07-05T12:07:57.070911" + }, + "test_cat_fastq_single_end_same_name - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": true + }, + "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ], + "1": [ + "versions.yml:md5,d42d6e24d67004608495883e00bd501b" + ], + "reads": [ + [ + { + "id": "test", + "single_end": true + }, + "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ], + "versions": [ + "versions.yml:md5,d42d6e24d67004608495883e00bd501b" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-07-05T12:07:46.796254" + }, "test_cat_fastq_paired_end": { "content": [ { @@ -164,6 +291,86 @@ ] } ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, "timestamp": "2024-01-17T17:32:02.270935" + }, + "test_cat_fastq_paired_end - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test_2.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] + ], + "1": [ + "versions.yml:md5,d42d6e24d67004608495883e00bd501b" + ], + "reads": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test_2.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] + ], + "versions": [ + "versions.yml:md5,d42d6e24d67004608495883e00bd501b" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-07-05T12:07:37.807553" + }, + "test_cat_fastq_single_end_single_file - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": true + }, + "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ], + "1": [ + "versions.yml:md5,d42d6e24d67004608495883e00bd501b" + ], + "reads": [ + [ + { + "id": "test", + "single_end": true + }, + "test.merged.fastq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ], + "versions": [ + "versions.yml:md5,d42d6e24d67004608495883e00bd501b" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-07-05T12:14:51.861264" } } \ No newline at end of file diff --git a/modules/nf-core/fastqc/tests/main.nf.test b/modules/nf-core/fastqc/tests/main.nf.test index 70edae4..e9d79a0 100644 --- a/modules/nf-core/fastqc/tests/main.nf.test +++ b/modules/nf-core/fastqc/tests/main.nf.test @@ -23,17 +23,14 @@ nextflow_process { then { assertAll ( - { assert process.success }, - - // NOTE The report contains the date inside it, which means that the md5sum is stable per day, but not longer than that. So you can't md5sum it. - // looks like this:
Mon 2 Oct 2023
test.gz
- // https://github.com/nf-core/modules/pull/3903#issuecomment-1743620039 - - { assert process.out.html[0][1] ==~ ".*/test_fastqc.html" }, - { assert process.out.zip[0][1] ==~ ".*/test_fastqc.zip" }, - { assert path(process.out.html[0][1]).text.contains("File typeConventional base calls") }, - - { assert snapshot(process.out.versions).match("fastqc_versions_single") } + { assert process.success }, + // NOTE The report contains the date inside it, which means that the md5sum is stable per day, but not longer than that. So you can't md5sum it. + // looks like this:
Mon 2 Oct 2023
test.gz
+ // https://github.com/nf-core/modules/pull/3903#issuecomment-1743620039 + { assert process.out.html[0][1] ==~ ".*/test_fastqc.html" }, + { assert process.out.zip[0][1] ==~ ".*/test_fastqc.zip" }, + { assert path(process.out.html[0][1]).text.contains("File typeConventional base calls") }, + { assert snapshot(process.out.versions).match() } ) } } @@ -54,16 +51,14 @@ nextflow_process { then { assertAll ( - { assert process.success }, - - { assert process.out.html[0][1][0] ==~ ".*/test_1_fastqc.html" }, - { assert process.out.html[0][1][1] ==~ ".*/test_2_fastqc.html" }, - { assert process.out.zip[0][1][0] ==~ ".*/test_1_fastqc.zip" }, - { assert process.out.zip[0][1][1] ==~ ".*/test_2_fastqc.zip" }, - { assert path(process.out.html[0][1][0]).text.contains("File typeConventional base calls") }, - { assert path(process.out.html[0][1][1]).text.contains("File typeConventional base calls") }, - - { assert snapshot(process.out.versions).match("fastqc_versions_paired") } + { assert process.success }, + { assert process.out.html[0][1][0] ==~ ".*/test_1_fastqc.html" }, + { assert process.out.html[0][1][1] ==~ ".*/test_2_fastqc.html" }, + { assert process.out.zip[0][1][0] ==~ ".*/test_1_fastqc.zip" }, + { assert process.out.zip[0][1][1] ==~ ".*/test_2_fastqc.zip" }, + { assert path(process.out.html[0][1][0]).text.contains("File typeConventional base calls") }, + { assert path(process.out.html[0][1][1]).text.contains("File typeConventional base calls") }, + { assert snapshot(process.out.versions).match() } ) } } @@ -83,13 +78,11 @@ nextflow_process { then { assertAll ( - { assert process.success }, - - { assert process.out.html[0][1] ==~ ".*/test_fastqc.html" }, - { assert process.out.zip[0][1] ==~ ".*/test_fastqc.zip" }, - { assert path(process.out.html[0][1]).text.contains("File typeConventional base calls") }, - - { assert snapshot(process.out.versions).match("fastqc_versions_interleaved") } + { assert process.success }, + { assert process.out.html[0][1] ==~ ".*/test_fastqc.html" }, + { assert process.out.zip[0][1] ==~ ".*/test_fastqc.zip" }, + { assert path(process.out.html[0][1]).text.contains("File typeConventional base calls") }, + { assert snapshot(process.out.versions).match() } ) } } @@ -109,13 +102,11 @@ nextflow_process { then { assertAll ( - { assert process.success }, - - { assert process.out.html[0][1] ==~ ".*/test_fastqc.html" }, - { assert process.out.zip[0][1] ==~ ".*/test_fastqc.zip" }, - { assert path(process.out.html[0][1]).text.contains("File typeConventional base calls") }, - - { assert snapshot(process.out.versions).match("fastqc_versions_bam") } + { assert process.success }, + { assert process.out.html[0][1] ==~ ".*/test_fastqc.html" }, + { assert process.out.zip[0][1] ==~ ".*/test_fastqc.zip" }, + { assert path(process.out.html[0][1]).text.contains("File typeConventional base calls") }, + { assert snapshot(process.out.versions).match() } ) } } @@ -138,22 +129,20 @@ nextflow_process { then { assertAll ( - { assert process.success }, - - { assert process.out.html[0][1][0] ==~ ".*/test_1_fastqc.html" }, - { assert process.out.html[0][1][1] ==~ ".*/test_2_fastqc.html" }, - { assert process.out.html[0][1][2] ==~ ".*/test_3_fastqc.html" }, - { assert process.out.html[0][1][3] ==~ ".*/test_4_fastqc.html" }, - { assert process.out.zip[0][1][0] ==~ ".*/test_1_fastqc.zip" }, - { assert process.out.zip[0][1][1] ==~ ".*/test_2_fastqc.zip" }, - { assert process.out.zip[0][1][2] ==~ ".*/test_3_fastqc.zip" }, - { assert process.out.zip[0][1][3] ==~ ".*/test_4_fastqc.zip" }, - { assert path(process.out.html[0][1][0]).text.contains("File typeConventional base calls") }, - { assert path(process.out.html[0][1][1]).text.contains("File typeConventional base calls") }, - { assert path(process.out.html[0][1][2]).text.contains("File typeConventional base calls") }, - { assert path(process.out.html[0][1][3]).text.contains("File typeConventional base calls") }, - - { assert snapshot(process.out.versions).match("fastqc_versions_multiple") } + { assert process.success }, + { assert process.out.html[0][1][0] ==~ ".*/test_1_fastqc.html" }, + { assert process.out.html[0][1][1] ==~ ".*/test_2_fastqc.html" }, + { assert process.out.html[0][1][2] ==~ ".*/test_3_fastqc.html" }, + { assert process.out.html[0][1][3] ==~ ".*/test_4_fastqc.html" }, + { assert process.out.zip[0][1][0] ==~ ".*/test_1_fastqc.zip" }, + { assert process.out.zip[0][1][1] ==~ ".*/test_2_fastqc.zip" }, + { assert process.out.zip[0][1][2] ==~ ".*/test_3_fastqc.zip" }, + { assert process.out.zip[0][1][3] ==~ ".*/test_4_fastqc.zip" }, + { assert path(process.out.html[0][1][0]).text.contains("File typeConventional base calls") }, + { assert path(process.out.html[0][1][1]).text.contains("File typeConventional base calls") }, + { assert path(process.out.html[0][1][2]).text.contains("File typeConventional base calls") }, + { assert path(process.out.html[0][1][3]).text.contains("File typeConventional base calls") }, + { assert snapshot(process.out.versions).match() } ) } } @@ -173,21 +162,18 @@ nextflow_process { then { assertAll ( - { assert process.success }, - - { assert process.out.html[0][1] ==~ ".*/mysample_fastqc.html" }, - { assert process.out.zip[0][1] ==~ ".*/mysample_fastqc.zip" }, - { assert path(process.out.html[0][1]).text.contains("File typeConventional base calls") }, - - { assert snapshot(process.out.versions).match("fastqc_versions_custom_prefix") } + { assert process.success }, + { assert process.out.html[0][1] ==~ ".*/mysample_fastqc.html" }, + { assert process.out.zip[0][1] ==~ ".*/mysample_fastqc.zip" }, + { assert path(process.out.html[0][1]).text.contains("File typeConventional base calls") }, + { assert snapshot(process.out.versions).match() } ) } } test("sarscov2 single-end [fastq] - stub") { - options "-stub" - + options "-stub" when { process { """ @@ -201,12 +187,123 @@ nextflow_process { then { assertAll ( - { assert process.success }, - { assert snapshot(process.out.html.collect { file(it[1]).getName() } + - process.out.zip.collect { file(it[1]).getName() } + - process.out.versions ).match("fastqc_stub") } + { assert process.success }, + { assert snapshot(process.out).match() } ) } } + test("sarscov2 paired-end [fastq] - stub") { + + options "-stub" + when { + process { + """ + input[0] = Channel.of([ + [id: 'test', single_end: false], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true) ] + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("sarscov2 interleaved [fastq] - stub") { + + options "-stub" + when { + process { + """ + input[0] = Channel.of([ + [id: 'test', single_end: false], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_interleaved.fastq.gz', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("sarscov2 paired-end [bam] - stub") { + + options "-stub" + when { + process { + """ + input[0] = Channel.of([ + [id: 'test', single_end: false], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("sarscov2 multiple [fastq] - stub") { + + options "-stub" + when { + process { + """ + input[0] = Channel.of([ + [id: 'test', single_end: false], // meta map + [ file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_2.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test2_1.fastq.gz', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test2_2.fastq.gz', checkIfExists: true) ] + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("sarscov2 custom_prefix - stub") { + + options "-stub" + when { + process { + """ + input[0] = Channel.of([ + [ id:'mysample', single_end:true ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } } diff --git a/modules/nf-core/fastqc/tests/main.nf.test.snap b/modules/nf-core/fastqc/tests/main.nf.test.snap index 86f7c31..d5db309 100644 --- a/modules/nf-core/fastqc/tests/main.nf.test.snap +++ b/modules/nf-core/fastqc/tests/main.nf.test.snap @@ -1,88 +1,392 @@ { - "fastqc_versions_interleaved": { + "sarscov2 custom_prefix": { "content": [ [ "versions.yml:md5,e1cc25ca8af856014824abd842e93978" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-01-31T17:40:07.293713" + "timestamp": "2024-07-22T11:02:16.374038" }, - "fastqc_stub": { + "sarscov2 single-end [fastq] - stub": { "content": [ - [ - "test.html", - "test.zip", - "versions.yml:md5,e1cc25ca8af856014824abd842e93978" - ] + { + "0": [ + [ + { + "id": "test", + "single_end": true + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": true + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "html": [ + [ + { + "id": "test", + "single_end": true + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "zip": [ + [ + { + "id": "test", + "single_end": true + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T11:02:24.993809" + }, + "sarscov2 custom_prefix - stub": { + "content": [ + { + "0": [ + [ + { + "id": "mysample", + "single_end": true + }, + "mysample.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "mysample", + "single_end": true + }, + "mysample.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "html": [ + [ + { + "id": "mysample", + "single_end": true + }, + "mysample.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "zip": [ + [ + { + "id": "mysample", + "single_end": true + }, + "mysample.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-01-31T17:31:01.425198" + "timestamp": "2024-07-22T11:03:10.93942" }, - "fastqc_versions_multiple": { + "sarscov2 interleaved [fastq]": { "content": [ [ "versions.yml:md5,e1cc25ca8af856014824abd842e93978" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-01-31T17:40:55.797907" + "timestamp": "2024-07-22T11:01:42.355718" }, - "fastqc_versions_bam": { + "sarscov2 paired-end [bam]": { "content": [ [ "versions.yml:md5,e1cc25ca8af856014824abd842e93978" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-01-31T17:40:26.795862" + "timestamp": "2024-07-22T11:01:53.276274" }, - "fastqc_versions_single": { + "sarscov2 multiple [fastq]": { "content": [ [ "versions.yml:md5,e1cc25ca8af856014824abd842e93978" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-01-31T17:39:27.043675" + "timestamp": "2024-07-22T11:02:05.527626" }, - "fastqc_versions_paired": { + "sarscov2 paired-end [fastq]": { "content": [ [ "versions.yml:md5,e1cc25ca8af856014824abd842e93978" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T11:01:31.188871" + }, + "sarscov2 paired-end [fastq] - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "html": [ + [ + { + "id": "test", + "single_end": false + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "zip": [ + [ + { + "id": "test", + "single_end": false + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T11:02:34.273566" + }, + "sarscov2 multiple [fastq] - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "html": [ + [ + { + "id": "test", + "single_end": false + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "zip": [ + [ + { + "id": "test", + "single_end": false + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-01-31T17:39:47.584191" + "timestamp": "2024-07-22T11:03:02.304411" }, - "fastqc_versions_custom_prefix": { + "sarscov2 single-end [fastq]": { "content": [ [ "versions.yml:md5,e1cc25ca8af856014824abd842e93978" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T11:01:19.095607" + }, + "sarscov2 interleaved [fastq] - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "html": [ + [ + { + "id": "test", + "single_end": false + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "zip": [ + [ + { + "id": "test", + "single_end": false + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T11:02:44.640184" + }, + "sarscov2 paired-end [bam] - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "html": [ + [ + { + "id": "test", + "single_end": false + }, + "test.html:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,e1cc25ca8af856014824abd842e93978" + ], + "zip": [ + [ + { + "id": "test", + "single_end": false + }, + "test.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-01-31T17:41:14.576531" + "timestamp": "2024-07-22T11:02:53.550742" } } \ No newline at end of file diff --git a/modules/nf-core/gunzip/environment.yml b/modules/nf-core/gunzip/environment.yml index 25910b3..dfc02a7 100644 --- a/modules/nf-core/gunzip/environment.yml +++ b/modules/nf-core/gunzip/environment.yml @@ -4,4 +4,6 @@ channels: - bioconda - defaults dependencies: - - conda-forge::sed=4.7 + - conda-forge::grep=3.11 + - conda-forge::sed=4.8 + - conda-forge::tar=1.34 diff --git a/modules/nf-core/gunzip/main.nf b/modules/nf-core/gunzip/main.nf index 468a6f2..5e67e3b 100644 --- a/modules/nf-core/gunzip/main.nf +++ b/modules/nf-core/gunzip/main.nf @@ -4,8 +4,8 @@ process GUNZIP { conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/ubuntu:20.04' : - 'nf-core/ubuntu:20.04' }" + 'https://depot.galaxyproject.org/singularity/ubuntu:22.04' : + 'nf-core/ubuntu:22.04' }" input: tuple val(meta), path(archive) @@ -18,8 +18,11 @@ process GUNZIP { task.ext.when == null || task.ext.when script: - def args = task.ext.args ?: '' - gunzip = archive.toString() - '.gz' + def args = task.ext.args ?: '' + def extension = ( archive.toString() - '.gz' ).tokenize('.')[-1] + def name = archive.toString() - '.gz' - ".$extension" + def prefix = task.ext.prefix ?: name + gunzip = prefix + ".$extension" """ # Not calling gunzip itself because it creates files # with the original group ownership rather than the @@ -37,7 +40,11 @@ process GUNZIP { """ stub: - gunzip = archive.toString() - '.gz' + def args = task.ext.args ?: '' + def extension = ( archive.toString() - '.gz' ).tokenize('.')[-1] + def name = archive.toString() - '.gz' - ".$extension" + def prefix = task.ext.prefix ?: name + gunzip = prefix + ".$extension" """ touch $gunzip cat <<-END_VERSIONS > versions.yml diff --git a/modules/nf-core/gunzip/meta.yml b/modules/nf-core/gunzip/meta.yml index 231034f..f32973a 100644 --- a/modules/nf-core/gunzip/meta.yml +++ b/modules/nf-core/gunzip/meta.yml @@ -37,3 +37,4 @@ maintainers: - "@joseespinosa" - "@drpatelh" - "@jfy133" + - "@gallvp" diff --git a/modules/nf-core/gunzip/tests/main.nf.test b/modules/nf-core/gunzip/tests/main.nf.test index 6406008..776211a 100644 --- a/modules/nf-core/gunzip/tests/main.nf.test +++ b/modules/nf-core/gunzip/tests/main.nf.test @@ -33,4 +33,89 @@ nextflow_process { } + test("Should run without failures - prefix") { + + config './nextflow.config' + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = Channel.of([ + [ id: 'test' ], + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) + ] + ) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + + test("Should run without failures - stub") { + + options '-stub' + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = Channel.of([ + [], + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) + ] + ) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + + test("Should run without failures - prefix - stub") { + + options '-stub' + config './nextflow.config' + + when { + params { + outdir = "$outputDir" + } + process { + """ + input[0] = Channel.of([ + [ id: 'test' ], + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/fastq/test_1.fastq.gz', checkIfExists: true) + ] + ) + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + } diff --git a/modules/nf-core/gunzip/tests/main.nf.test.snap b/modules/nf-core/gunzip/tests/main.nf.test.snap index 720fd9f..069967e 100644 --- a/modules/nf-core/gunzip/tests/main.nf.test.snap +++ b/modules/nf-core/gunzip/tests/main.nf.test.snap @@ -1,4 +1,70 @@ { + "Should run without failures - prefix - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + "test.xyz.fastq:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + "versions.yml:md5,54376d32aca20e937a4ec26dac228e84" + ], + "gunzip": [ + [ + { + "id": "test" + }, + "test.xyz.fastq:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,54376d32aca20e937a4ec26dac228e84" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-06-25T11:35:10.861293" + }, + "Should run without failures - stub": { + "content": [ + { + "0": [ + [ + [ + + ], + "test_1.fastq:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + "versions.yml:md5,54376d32aca20e937a4ec26dac228e84" + ], + "gunzip": [ + [ + [ + + ], + "test_1.fastq:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,54376d32aca20e937a4ec26dac228e84" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-06-25T11:35:05.857145" + }, "Should run without failures": { "content": [ { @@ -26,6 +92,43 @@ ] } ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, "timestamp": "2023-10-17T15:35:37.690477896" + }, + "Should run without failures - prefix": { + "content": [ + { + "0": [ + [ + { + "id": "test" + }, + "test.xyz.fastq:md5,4161df271f9bfcd25d5845a1e220dbec" + ] + ], + "1": [ + "versions.yml:md5,54376d32aca20e937a4ec26dac228e84" + ], + "gunzip": [ + [ + { + "id": "test" + }, + "test.xyz.fastq:md5,4161df271f9bfcd25d5845a1e220dbec" + ] + ], + "versions": [ + "versions.yml:md5,54376d32aca20e937a4ec26dac228e84" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-06-25T11:33:32.921739" } } \ No newline at end of file diff --git a/modules/nf-core/gunzip/tests/nextflow.config b/modules/nf-core/gunzip/tests/nextflow.config new file mode 100644 index 0000000..dec7764 --- /dev/null +++ b/modules/nf-core/gunzip/tests/nextflow.config @@ -0,0 +1,5 @@ +process { + withName: GUNZIP { + ext.prefix = { "${meta.id}.xyz" } + } +} diff --git a/modules/nf-core/multiqc/environment.yml b/modules/nf-core/multiqc/environment.yml index 72e598b..2121492 100644 --- a/modules/nf-core/multiqc/environment.yml +++ b/modules/nf-core/multiqc/environment.yml @@ -4,4 +4,4 @@ channels: - bioconda - defaults dependencies: - - bioconda::multiqc=1.22.2 + - bioconda::multiqc=1.23 diff --git a/modules/nf-core/multiqc/main.nf b/modules/nf-core/multiqc/main.nf index e59efef..459dfea 100644 --- a/modules/nf-core/multiqc/main.nf +++ b/modules/nf-core/multiqc/main.nf @@ -3,14 +3,16 @@ process MULTIQC { conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/multiqc:1.22.2--pyhdfd78af_0' : - 'biocontainers/multiqc:1.22.2--pyhdfd78af_0' }" + 'https://depot.galaxyproject.org/singularity/multiqc:1.23--pyhdfd78af_0' : + 'biocontainers/multiqc:1.23--pyhdfd78af_0' }" input: path multiqc_files, stageAs: "?/*" path(multiqc_config) path(extra_multiqc_config) path(multiqc_logo) + path(replace_names) + path(sample_names) output: path "*multiqc_report.html", emit: report @@ -26,6 +28,8 @@ process MULTIQC { def config = multiqc_config ? "--config $multiqc_config" : '' def extra_config = extra_multiqc_config ? "--config $extra_multiqc_config" : '' def logo = multiqc_logo ? /--cl-config 'custom_logo: "${multiqc_logo}"'/ : '' + def replace = replace_names ? "--replace-names ${replace_names}" : '' + def samples = sample_names ? "--sample-names ${sample_names}" : '' """ multiqc \\ --force \\ @@ -33,6 +37,8 @@ process MULTIQC { $config \\ $extra_config \\ $logo \\ + $replace \\ + $samples \\ . cat <<-END_VERSIONS > versions.yml diff --git a/modules/nf-core/multiqc/meta.yml b/modules/nf-core/multiqc/meta.yml index 45a9bc3..382c08c 100644 --- a/modules/nf-core/multiqc/meta.yml +++ b/modules/nf-core/multiqc/meta.yml @@ -29,6 +29,19 @@ input: type: file description: Optional logo file for MultiQC pattern: "*.{png}" + - replace_names: + type: file + description: | + Optional two-column sample renaming file. First column a set of + patterns, second column a set of corresponding replacements. Passed via + MultiQC's `--replace-names` option. + pattern: "*.{tsv}" + - sample_names: + type: file + description: | + Optional TSV file with headers, passed to the MultiQC --sample_names + argument. + pattern: "*.{tsv}" output: - report: type: file diff --git a/modules/nf-core/multiqc/tests/main.nf.test b/modules/nf-core/multiqc/tests/main.nf.test index f1c4242..6aa27f4 100644 --- a/modules/nf-core/multiqc/tests/main.nf.test +++ b/modules/nf-core/multiqc/tests/main.nf.test @@ -17,6 +17,8 @@ nextflow_process { input[1] = [] input[2] = [] input[3] = [] + input[4] = [] + input[5] = [] """ } } @@ -41,6 +43,8 @@ nextflow_process { input[1] = Channel.of(file("https://github.com/nf-core/tools/raw/dev/nf_core/pipeline-template/assets/multiqc_config.yml", checkIfExists: true)) input[2] = [] input[3] = [] + input[4] = [] + input[5] = [] """ } } @@ -66,6 +70,8 @@ nextflow_process { input[1] = [] input[2] = [] input[3] = [] + input[4] = [] + input[5] = [] """ } } diff --git a/modules/nf-core/multiqc/tests/main.nf.test.snap b/modules/nf-core/multiqc/tests/main.nf.test.snap index a170c31..45e95e5 100644 --- a/modules/nf-core/multiqc/tests/main.nf.test.snap +++ b/modules/nf-core/multiqc/tests/main.nf.test.snap @@ -2,14 +2,14 @@ "multiqc_versions_single": { "content": [ [ - "versions.yml:md5,ddbc971a8307f9b9b7b973714cde29d0" + "versions.yml:md5,87904cd321df21fac35d18f0fc01bb19" ] ], "meta": { "nf-test": "0.8.4", "nextflow": "24.04.2" }, - "timestamp": "2024-06-10T11:50:10.874341679" + "timestamp": "2024-07-10T12:41:34.562023" }, "multiqc_stub": { "content": [ @@ -17,25 +17,25 @@ "multiqc_report.html", "multiqc_data", "multiqc_plots", - "versions.yml:md5,ddbc971a8307f9b9b7b973714cde29d0" + "versions.yml:md5,87904cd321df21fac35d18f0fc01bb19" ] ], "meta": { "nf-test": "0.8.4", "nextflow": "24.04.2" }, - "timestamp": "2024-06-10T11:50:49.271943761" + "timestamp": "2024-07-10T11:27:11.933869532" }, "multiqc_versions_config": { "content": [ [ - "versions.yml:md5,ddbc971a8307f9b9b7b973714cde29d0" + "versions.yml:md5,87904cd321df21fac35d18f0fc01bb19" ] ], "meta": { "nf-test": "0.8.4", "nextflow": "24.04.2" }, - "timestamp": "2024-06-10T11:50:34.046706025" + "timestamp": "2024-07-10T11:26:56.709849369" } } \ No newline at end of file diff --git a/modules/nf-core/samtools/flagstat/tests/main.nf.test b/modules/nf-core/samtools/flagstat/tests/main.nf.test index 24c3c04..3b648a3 100644 --- a/modules/nf-core/samtools/flagstat/tests/main.nf.test +++ b/modules/nf-core/samtools/flagstat/tests/main.nf.test @@ -11,9 +11,30 @@ nextflow_process { test("BAM") { when { - params { - outdir = "$outputDir" + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam.bai', checkIfExists: true) + ]) + """ } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("BAM - stub") { + + options "-stub" + + when { process { """ input[0] = Channel.of([ @@ -28,8 +49,7 @@ nextflow_process { then { assertAll ( { assert process.success }, - { assert snapshot(process.out.flagstat).match("flagstat") }, - { assert snapshot(process.out.versions).match("versions") } + { assert snapshot(process.out).match() } ) } } diff --git a/modules/nf-core/samtools/flagstat/tests/main.nf.test.snap b/modules/nf-core/samtools/flagstat/tests/main.nf.test.snap index e9f85ef..23989c6 100644 --- a/modules/nf-core/samtools/flagstat/tests/main.nf.test.snap +++ b/modules/nf-core/samtools/flagstat/tests/main.nf.test.snap @@ -1,32 +1,72 @@ { - "flagstat": { + "BAM - stub": { "content": [ - [ - [ - { - "id": "test", - "single_end": false - }, - "test.flagstat:md5,4f7ffd1e6a5e85524d443209ac97d783" + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.flagstat:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + "versions.yml:md5,f606681ef971cbb548a4d9e3fbabdbc2" + ], + "flagstat": [ + [ + { + "id": "test", + "single_end": false + }, + "test.flagstat:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,f606681ef971cbb548a4d9e3fbabdbc2" ] - ] + } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.04.3" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-02-12T18:31:37.783927" + "timestamp": "2024-07-22T14:17:28.002887" }, - "versions": { + "BAM": { "content": [ - [ - "versions.yml:md5,f606681ef971cbb548a4d9e3fbabdbc2" - ] + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.flagstat:md5,4f7ffd1e6a5e85524d443209ac97d783" + ] + ], + "1": [ + "versions.yml:md5,f606681ef971cbb548a4d9e3fbabdbc2" + ], + "flagstat": [ + [ + { + "id": "test", + "single_end": false + }, + "test.flagstat:md5,4f7ffd1e6a5e85524d443209ac97d783" + ] + ], + "versions": [ + "versions.yml:md5,f606681ef971cbb548a4d9e3fbabdbc2" + ] + } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-05-28T15:41:52.516253882" + "timestamp": "2024-07-22T14:17:13.330971" } } \ No newline at end of file diff --git a/modules/nf-core/samtools/idxstats/environment.yml b/modules/nf-core/samtools/idxstats/environment.yml index 174973b..eb6c880 100644 --- a/modules/nf-core/samtools/idxstats/environment.yml +++ b/modules/nf-core/samtools/idxstats/environment.yml @@ -4,5 +4,5 @@ channels: - bioconda - defaults dependencies: - - bioconda::samtools=1.19.2 - - bioconda::htslib=1.19.1 + - bioconda::samtools=1.20 + - bioconda::htslib=1.20 diff --git a/modules/nf-core/samtools/idxstats/main.nf b/modules/nf-core/samtools/idxstats/main.nf index a544026..2ea2a5c 100644 --- a/modules/nf-core/samtools/idxstats/main.nf +++ b/modules/nf-core/samtools/idxstats/main.nf @@ -4,8 +4,8 @@ process SAMTOOLS_IDXSTATS { conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/samtools:1.19.2--h50ea8bc_0' : - 'biocontainers/samtools:1.19.2--h50ea8bc_0' }" + 'https://depot.galaxyproject.org/singularity/samtools:1.20--h50ea8bc_0' : + 'biocontainers/samtools:1.20--h50ea8bc_0' }" input: tuple val(meta), path(bam), path(bai) diff --git a/modules/nf-core/samtools/idxstats/tests/main.nf.test b/modules/nf-core/samtools/idxstats/tests/main.nf.test index a2dcb27..5fd1fc7 100644 --- a/modules/nf-core/samtools/idxstats/tests/main.nf.test +++ b/modules/nf-core/samtools/idxstats/tests/main.nf.test @@ -11,9 +11,6 @@ nextflow_process { test("bam") { when { - params { - outdir = "$outputDir" - } process { """ input[0] = Channel.of([ @@ -28,9 +25,29 @@ nextflow_process { then { assertAll ( { assert process.success }, - { assert snapshot(process.out.idxstats).match("idxstats") }, - { assert snapshot(process.out.versions).match("versions") } + { assert snapshot(process.out).match() } ) } } -} + + test("bam - stub") { + options "-stub" + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam.bai', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + }} diff --git a/modules/nf-core/samtools/idxstats/tests/main.nf.test.snap b/modules/nf-core/samtools/idxstats/tests/main.nf.test.snap index a7050bd..a5ac810 100644 --- a/modules/nf-core/samtools/idxstats/tests/main.nf.test.snap +++ b/modules/nf-core/samtools/idxstats/tests/main.nf.test.snap @@ -1,32 +1,72 @@ { - "versions": { + "bam - stub": { "content": [ - [ - "versions.yml:md5,613dde56f108418039ffcdeeddba397a" - ] + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.idxstats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + "versions.yml:md5,7acbcb2a8ec6436ba7b2916d3ff13351" + ], + "idxstats": [ + [ + { + "id": "test", + "single_end": false + }, + "test.idxstats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,7acbcb2a8ec6436ba7b2916d3ff13351" + ] + } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-02-13T16:16:50.147462763" + "timestamp": "2024-07-22T14:17:56.180093" }, - "idxstats": { + "bam": { "content": [ - [ - [ - { - "id": "test", - "single_end": false - }, - "test.idxstats:md5,df60a8c8d6621100d05178c93fb053a2" + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.idxstats:md5,df60a8c8d6621100d05178c93fb053a2" + ] + ], + "1": [ + "versions.yml:md5,7acbcb2a8ec6436ba7b2916d3ff13351" + ], + "idxstats": [ + [ + { + "id": "test", + "single_end": false + }, + "test.idxstats:md5,df60a8c8d6621100d05178c93fb053a2" + ] + ], + "versions": [ + "versions.yml:md5,7acbcb2a8ec6436ba7b2916d3ff13351" ] - ] + } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.04.3" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-02-12T18:36:41.561026" + "timestamp": "2024-07-22T14:17:41.408704" } } \ No newline at end of file diff --git a/modules/nf-core/samtools/index/main.nf b/modules/nf-core/samtools/index/main.nf index b523c21..e002585 100644 --- a/modules/nf-core/samtools/index/main.nf +++ b/modules/nf-core/samtools/index/main.nf @@ -35,10 +35,11 @@ process SAMTOOLS_INDEX { """ stub: + def args = task.ext.args ?: '' + def extension = file(input).getExtension() == 'cram' ? + "crai" : args.contains("-c") ? "csi" : "bai" """ - touch ${input}.bai - touch ${input}.crai - touch ${input}.csi + touch ${input}.${extension} cat <<-END_VERSIONS > versions.yml "${task.process}": diff --git a/modules/nf-core/samtools/index/tests/main.nf.test b/modules/nf-core/samtools/index/tests/main.nf.test index bb7756d..ca34fb5 100644 --- a/modules/nf-core/samtools/index/tests/main.nf.test +++ b/modules/nf-core/samtools/index/tests/main.nf.test @@ -9,11 +9,7 @@ nextflow_process { tag "samtools/index" test("bai") { - when { - params { - outdir = "$outputDir" - } process { """ input[0] = Channel.of([ @@ -27,18 +23,13 @@ nextflow_process { then { assertAll ( { assert process.success }, - { assert snapshot(process.out.bai).match("bai") }, - { assert snapshot(process.out.versions).match("bai_versions") } + { assert snapshot(process.out).match() } ) } } test("crai") { - when { - params { - outdir = "$outputDir" - } process { """ input[0] = Channel.of([ @@ -52,20 +43,83 @@ nextflow_process { then { assertAll ( { assert process.success }, - { assert snapshot(process.out.crai).match("crai") }, - { assert snapshot(process.out.versions).match("crai_versions") } + { assert snapshot(process.out).match() } ) } } test("csi") { - config "./csi.nextflow.config" when { - params { - outdir = "$outputDir" + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot( + file(process.out.csi[0][1]).name, + process.out.versions + ).match() } + ) + } + } + + test("bai - stub") { + options "-stub" + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("crai - stub") { + options "-stub" + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.recalibrated.sorted.cram', checkIfExists: true) + ]) + """ } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + + test("csi - stub") { + options "-stub" + config "./csi.nextflow.config" + + when { process { """ input[0] = Channel.of([ @@ -79,8 +133,7 @@ nextflow_process { then { assertAll ( { assert process.success }, - { assert path(process.out.csi.get(0).get(1)).exists() }, - { assert snapshot(process.out.versions).match("csi_versions") } + { assert snapshot(process.out).match() } ) } } diff --git a/modules/nf-core/samtools/index/tests/main.nf.test.snap b/modules/nf-core/samtools/index/tests/main.nf.test.snap index 52756e8..799d199 100644 --- a/modules/nf-core/samtools/index/tests/main.nf.test.snap +++ b/modules/nf-core/samtools/index/tests/main.nf.test.snap @@ -1,74 +1,250 @@ { - "crai_versions": { + "csi - stub": { "content": [ - [ - "versions.yml:md5,802c9776d9c5e95314e888cf18e96d77" - ] + { + "0": [ + + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test.paired_end.sorted.bam.csi:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + + ], + "3": [ + "versions.yml:md5,802c9776d9c5e95314e888cf18e96d77" + ], + "bai": [ + + ], + "crai": [ + + ], + "csi": [ + [ + { + "id": "test", + "single_end": false + }, + "test.paired_end.sorted.bam.csi:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,802c9776d9c5e95314e888cf18e96d77" + ] + } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-05-28T15:42:04.203740976" + "timestamp": "2024-07-22T16:51:53.9057" }, - "csi_versions": { + "crai - stub": { "content": [ - [ - "versions.yml:md5,802c9776d9c5e95314e888cf18e96d77" - ] + { + "0": [ + + ], + "1": [ + + ], + "2": [ + [ + { + "id": "test", + "single_end": false + }, + "test.paired_end.recalibrated.sorted.cram.crai:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + "versions.yml:md5,802c9776d9c5e95314e888cf18e96d77" + ], + "bai": [ + + ], + "crai": [ + [ + { + "id": "test", + "single_end": false + }, + "test.paired_end.recalibrated.sorted.cram.crai:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "csi": [ + + ], + "versions": [ + "versions.yml:md5,802c9776d9c5e95314e888cf18e96d77" + ] + } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-05-28T15:42:09.57475878" + "timestamp": "2024-07-22T16:51:45.931558" }, - "crai": { + "bai - stub": { "content": [ - [ - [ - { - "id": "test", - "single_end": false - }, - "test.paired_end.recalibrated.sorted.cram.crai:md5,14bc3bd5c89cacc8f4541f9062429029" + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.paired_end.sorted.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + + ], + "2": [ + + ], + "3": [ + "versions.yml:md5,802c9776d9c5e95314e888cf18e96d77" + ], + "bai": [ + [ + { + "id": "test", + "single_end": false + }, + "test.paired_end.sorted.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "crai": [ + + ], + "csi": [ + + ], + "versions": [ + "versions.yml:md5,802c9776d9c5e95314e888cf18e96d77" ] - ] + } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.04.3" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-02-12T18:41:38.446424" + "timestamp": "2024-07-22T16:51:34.807525" }, - "bai": { + "csi": { "content": [ + "test.paired_end.sorted.bam.csi", [ - [ - { - "id": "test", - "single_end": false - }, - "test.paired_end.sorted.bam.bai:md5,704c10dd1326482448ca3073fdebc2f4" - ] + "versions.yml:md5,802c9776d9c5e95314e888cf18e96d77" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.04.3" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-02-12T18:40:46.579747" + "timestamp": "2024-07-22T16:52:55.688799" }, - "bai_versions": { + "crai": { "content": [ - [ - "versions.yml:md5,802c9776d9c5e95314e888cf18e96d77" - ] + { + "0": [ + + ], + "1": [ + + ], + "2": [ + [ + { + "id": "test", + "single_end": false + }, + "test.paired_end.recalibrated.sorted.cram.crai:md5,14bc3bd5c89cacc8f4541f9062429029" + ] + ], + "3": [ + "versions.yml:md5,802c9776d9c5e95314e888cf18e96d77" + ], + "bai": [ + + ], + "crai": [ + [ + { + "id": "test", + "single_end": false + }, + "test.paired_end.recalibrated.sorted.cram.crai:md5,14bc3bd5c89cacc8f4541f9062429029" + ] + ], + "csi": [ + + ], + "versions": [ + "versions.yml:md5,802c9776d9c5e95314e888cf18e96d77" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T16:51:17.609533" + }, + "bai": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.paired_end.sorted.bam.bai:md5,704c10dd1326482448ca3073fdebc2f4" + ] + ], + "1": [ + + ], + "2": [ + + ], + "3": [ + "versions.yml:md5,802c9776d9c5e95314e888cf18e96d77" + ], + "bai": [ + [ + { + "id": "test", + "single_end": false + }, + "test.paired_end.sorted.bam.bai:md5,704c10dd1326482448ca3073fdebc2f4" + ] + ], + "crai": [ + + ], + "csi": [ + + ], + "versions": [ + "versions.yml:md5,802c9776d9c5e95314e888cf18e96d77" + ] + } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-05-28T15:41:57.929287369" + "timestamp": "2024-07-22T16:51:04.16585" } } \ No newline at end of file diff --git a/modules/nf-core/samtools/sort/environment.yml b/modules/nf-core/samtools/sort/environment.yml index 4d898e4..36a12ea 100644 --- a/modules/nf-core/samtools/sort/environment.yml +++ b/modules/nf-core/samtools/sort/environment.yml @@ -4,5 +4,5 @@ channels: - bioconda - defaults dependencies: - - bioconda::samtools=1.19.2 - - bioconda::htslib=1.19.1 + - bioconda::samtools=1.20 + - bioconda::htslib=1.20 diff --git a/modules/nf-core/samtools/sort/main.nf b/modules/nf-core/samtools/sort/main.nf index fc374f9..8e01909 100644 --- a/modules/nf-core/samtools/sort/main.nf +++ b/modules/nf-core/samtools/sort/main.nf @@ -4,8 +4,8 @@ process SAMTOOLS_SORT { conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/samtools:1.19.2--h50ea8bc_0' : - 'biocontainers/samtools:1.19.2--h50ea8bc_0' }" + 'https://depot.galaxyproject.org/singularity/samtools:1.20--h50ea8bc_0' : + 'biocontainers/samtools:1.20--h50ea8bc_0' }" input: tuple val(meta) , path(bam) @@ -50,10 +50,20 @@ process SAMTOOLS_SORT { """ stub: + def args = task.ext.args ?: '' def prefix = task.ext.prefix ?: "${meta.id}" + def extension = args.contains("--output-fmt sam") ? "sam" : + args.contains("--output-fmt cram") ? "cram" : + "bam" """ - touch ${prefix}.bam - touch ${prefix}.bam.csi + touch ${prefix}.${extension} + if [ "${extension}" == "bam" ]; + then + touch ${prefix}.${extension}.csi + elif [ "${extension}" == "cram" ]; + then + touch ${prefix}.${extension}.crai + fi cat <<-END_VERSIONS > versions.yml "${task.process}": diff --git a/modules/nf-core/samtools/sort/tests/main.nf.test b/modules/nf-core/samtools/sort/tests/main.nf.test index 8360e2b..c2ea9c7 100644 --- a/modules/nf-core/samtools/sort/tests/main.nf.test +++ b/modules/nf-core/samtools/sort/tests/main.nf.test @@ -30,13 +30,49 @@ nextflow_process { then { assertAll ( { assert process.success }, - { assert snapshot(process.out).match() } + { assert snapshot( + process.out.bam, + process.out.csi.collect { it.collect { it instanceof Map ? it : file(it).name } }, + process.out.versions + ).match()} ) } } test("cram") { + config "./nextflow_cram.config" + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram', checkIfExists: true) + ]) + input[1] = Channel.of([ + [ id:'fasta' ], // meta map + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot( + process.out.cram.collect { it.collect { it instanceof Map ? it : file(it).name } }, + process.out.crai.collect { it.collect { it instanceof Map ? it : file(it).name } }, + process.out.versions + ).match()} + ) + } + } + + test("bam - stub") { + + options "-stub" config "./nextflow.config" when { @@ -62,24 +98,21 @@ nextflow_process { } } - test("bam_stub") { + test("cram - stub") { - config "./nextflow.config" options "-stub" + config "./nextflow_cram.config" when { - params { - outdir = "$outputDir" - } process { """ input[0] = Channel.of([ [ id:'test', single_end:false ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.bam', checkIfExists: true) + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram', checkIfExists: true) ]) input[1] = Channel.of([ [ id:'fasta' ], // meta map - file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) ]) """ } @@ -88,8 +121,7 @@ nextflow_process { then { assertAll ( { assert process.success }, - { assert snapshot(file(process.out.bam[0][1]).name).match("bam_stub_bam") }, - { assert snapshot(process.out.versions).match("bam_stub_versions") } + { assert snapshot(process.out).match() } ) } } diff --git a/modules/nf-core/samtools/sort/tests/main.nf.test.snap b/modules/nf-core/samtools/sort/tests/main.nf.test.snap index 3847765..da38d5d 100644 --- a/modules/nf-core/samtools/sort/tests/main.nf.test.snap +++ b/modules/nf-core/samtools/sort/tests/main.nf.test.snap @@ -1,5 +1,35 @@ { "cram": { + "content": [ + [ + [ + { + "id": "test", + "single_end": false + }, + "test.sorted.cram" + ] + ], + [ + [ + { + "id": "test", + "single_end": false + }, + "test.sorted.cram.crai" + ] + ], + [ + "versions.yml:md5,7a360de20e1d7a6f15a5e8fbe0a9c062" + ] + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T17:19:37.196205" + }, + "bam - stub": { "content": [ { "0": [ @@ -8,7 +38,7 @@ "id": "test", "single_end": false }, - "test.sorted.bam:md5,bc0b7c25da26384a006ed84cc9e4da23" + "test.sorted.bam:md5,d41d8cd98f00b204e9800998ecf8427e" ] ], "1": [ @@ -23,11 +53,11 @@ "id": "test", "single_end": false }, - "test.sorted.bam.csi:md5,8d4e836c2fed6c0bf874d5e8cdba5831" + "test.sorted.bam.csi:md5,d41d8cd98f00b204e9800998ecf8427e" ] ], "4": [ - "versions.yml:md5,e6d43fefc9a8bff91c2ce6e3a1716eca" + "versions.yml:md5,7a360de20e1d7a6f15a5e8fbe0a9c062" ], "bam": [ [ @@ -35,7 +65,7 @@ "id": "test", "single_end": false }, - "test.sorted.bam:md5,bc0b7c25da26384a006ed84cc9e4da23" + "test.sorted.bam:md5,d41d8cd98f00b204e9800998ecf8427e" ] ], "crai": [ @@ -50,105 +80,113 @@ "id": "test", "single_end": false }, - "test.sorted.bam.csi:md5,8d4e836c2fed6c0bf874d5e8cdba5831" + "test.sorted.bam.csi:md5,d41d8cd98f00b204e9800998ecf8427e" ] ], "versions": [ - "versions.yml:md5,e6d43fefc9a8bff91c2ce6e3a1716eca" + "versions.yml:md5,7a360de20e1d7a6f15a5e8fbe0a9c062" ] } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" - }, - "timestamp": "2024-03-04T15:08:00.830294" - }, - "bam_stub_bam": { - "content": [ - "test.sorted.bam" - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.04.3" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-02-12T19:21:04.364044" + "timestamp": "2024-07-22T15:54:46.580756" }, - "bam_stub_versions": { - "content": [ - [ - "versions.yml:md5,e6d43fefc9a8bff91c2ce6e3a1716eca" - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-02-13T16:15:00.20800281" - }, - "bam": { + "cram - stub": { "content": [ { "0": [ + + ], + "1": [ [ { "id": "test", "single_end": false }, - "test.sorted.bam:md5,bc0b7c25da26384a006ed84cc9e4da23" + "test.sorted.cram:md5,d41d8cd98f00b204e9800998ecf8427e" ] - ], - "1": [ - ], "2": [ - - ], - "3": [ [ { "id": "test", "single_end": false }, - "test.sorted.bam.csi:md5,8d4e836c2fed6c0bf874d5e8cdba5831" + "test.sorted.cram.crai:md5,d41d8cd98f00b204e9800998ecf8427e" ] + ], + "3": [ + ], "4": [ - "versions.yml:md5,e6d43fefc9a8bff91c2ce6e3a1716eca" + "versions.yml:md5,7a360de20e1d7a6f15a5e8fbe0a9c062" ], "bam": [ + + ], + "crai": [ [ { "id": "test", "single_end": false }, - "test.sorted.bam:md5,bc0b7c25da26384a006ed84cc9e4da23" + "test.sorted.cram.crai:md5,d41d8cd98f00b204e9800998ecf8427e" ] - ], - "crai": [ - ], "cram": [ - - ], - "csi": [ [ { "id": "test", "single_end": false }, - "test.sorted.bam.csi:md5,8d4e836c2fed6c0bf874d5e8cdba5831" + "test.sorted.cram:md5,d41d8cd98f00b204e9800998ecf8427e" ] + ], + "csi": [ + ], "versions": [ - "versions.yml:md5,e6d43fefc9a8bff91c2ce6e3a1716eca" + "versions.yml:md5,7a360de20e1d7a6f15a5e8fbe0a9c062" ] } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T15:57:30.505698" + }, + "bam": { + "content": [ + [ + [ + { + "id": "test", + "single_end": false + }, + "test.sorted.bam:md5,21c992d59615936b99f2ad008aa54400" + ] + ], + [ + [ + { + "id": "test", + "single_end": false + }, + "test.sorted.bam.csi" + ] + ], + [ + "versions.yml:md5,7a360de20e1d7a6f15a5e8fbe0a9c062" + ] + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-03-04T15:07:48.773803" + "timestamp": "2024-07-22T15:54:25.872954" } } \ No newline at end of file diff --git a/modules/nf-core/samtools/sort/tests/nextflow_cram.config b/modules/nf-core/samtools/sort/tests/nextflow_cram.config new file mode 100644 index 0000000..3a8c018 --- /dev/null +++ b/modules/nf-core/samtools/sort/tests/nextflow_cram.config @@ -0,0 +1,8 @@ +process { + + withName: SAMTOOLS_SORT { + ext.prefix = { "${meta.id}.sorted" } + ext.args = "--write-index --output-fmt cram" + } + +} diff --git a/modules/nf-core/samtools/stats/environment.yml b/modules/nf-core/samtools/stats/environment.yml index 67bb0ca..1cc83bd 100644 --- a/modules/nf-core/samtools/stats/environment.yml +++ b/modules/nf-core/samtools/stats/environment.yml @@ -4,5 +4,5 @@ channels: - bioconda - defaults dependencies: - - bioconda::samtools=1.19.2 - - bioconda::htslib=1.19.1 + - bioconda::samtools=1.20 + - bioconda::htslib=1.20 diff --git a/modules/nf-core/samtools/stats/main.nf b/modules/nf-core/samtools/stats/main.nf index 52b00f4..982bc28 100644 --- a/modules/nf-core/samtools/stats/main.nf +++ b/modules/nf-core/samtools/stats/main.nf @@ -4,8 +4,8 @@ process SAMTOOLS_STATS { conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/samtools:1.19.2--h50ea8bc_0' : - 'biocontainers/samtools:1.19.2--h50ea8bc_0' }" + 'https://depot.galaxyproject.org/singularity/samtools:1.20--h50ea8bc_0' : + 'biocontainers/samtools:1.20--h50ea8bc_0' }" input: tuple val(meta), path(input), path(input_index) diff --git a/modules/nf-core/samtools/stats/tests/main.nf.test b/modules/nf-core/samtools/stats/tests/main.nf.test index e3d5cb1..28a77db 100644 --- a/modules/nf-core/samtools/stats/tests/main.nf.test +++ b/modules/nf-core/samtools/stats/tests/main.nf.test @@ -11,9 +11,6 @@ nextflow_process { test("bam") { when { - params { - outdir = "$outputDir" - } process { """ input[0] = Channel.of([ @@ -37,9 +34,59 @@ nextflow_process { test("cram") { when { - params { - outdir = "$outputDir" + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.recalibrated.sorted.cram', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.recalibrated.sorted.cram.crai', checkIfExists: true) + ]) + input[1] = Channel.of([ + [ id:'genome' ], // meta map + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) + ]) + """ } + } + + then { + assertAll( + {assert process.success}, + {assert snapshot(process.out).match()} + ) + } + } + + test("bam - stub") { + + options "-stub" + + when { + process { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam.bai', checkIfExists: true) + ]) + input[1] = [[],[]] + """ + } + } + + then { + assertAll( + {assert process.success}, + {assert snapshot(process.out).match()} + ) + } + } + + test("cram - stub") { + + options "-stub" + + when { process { """ input[0] = Channel.of([ diff --git a/modules/nf-core/samtools/stats/tests/main.nf.test.snap b/modules/nf-core/samtools/stats/tests/main.nf.test.snap index 1b7c9ba..3828f37 100644 --- a/modules/nf-core/samtools/stats/tests/main.nf.test.snap +++ b/modules/nf-core/samtools/stats/tests/main.nf.test.snap @@ -8,11 +8,11 @@ "id": "test", "single_end": false }, - "test.stats:md5,01812900aa4027532906c5d431114233" + "test.stats:md5,c9d39b38c22de2057fc2f89949090975" ] ], "1": [ - "versions.yml:md5,0514ceb1769b2a88843e08c1f82624a9" + "versions.yml:md5,b3b70b126f867fdbb7dcea5e36e49d4a" ], "stats": [ [ @@ -20,19 +20,89 @@ "id": "test", "single_end": false }, - "test.stats:md5,01812900aa4027532906c5d431114233" + "test.stats:md5,c9d39b38c22de2057fc2f89949090975" ] ], "versions": [ - "versions.yml:md5,0514ceb1769b2a88843e08c1f82624a9" + "versions.yml:md5,b3b70b126f867fdbb7dcea5e36e49d4a" ] } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-02-13T16:15:25.562429714" + "timestamp": "2024-07-22T14:20:24.885816" + }, + "bam - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.stats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + "versions.yml:md5,b3b70b126f867fdbb7dcea5e36e49d4a" + ], + "stats": [ + [ + { + "id": "test", + "single_end": false + }, + "test.stats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,b3b70b126f867fdbb7dcea5e36e49d4a" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T14:20:39.310713" + }, + "cram - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.stats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + "versions.yml:md5,b3b70b126f867fdbb7dcea5e36e49d4a" + ], + "stats": [ + [ + { + "id": "test", + "single_end": false + }, + "test.stats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,b3b70b126f867fdbb7dcea5e36e49d4a" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T14:21:04.771199" }, "bam": { "content": [ @@ -43,11 +113,11 @@ "id": "test", "single_end": false }, - "test.stats:md5,5d8681bf541199898c042bf400391d59" + "test.stats:md5,d522a1fa016b259d6a55620ae53dcd63" ] ], "1": [ - "versions.yml:md5,0514ceb1769b2a88843e08c1f82624a9" + "versions.yml:md5,b3b70b126f867fdbb7dcea5e36e49d4a" ], "stats": [ [ @@ -55,18 +125,18 @@ "id": "test", "single_end": false }, - "test.stats:md5,5d8681bf541199898c042bf400391d59" + "test.stats:md5,d522a1fa016b259d6a55620ae53dcd63" ] ], "versions": [ - "versions.yml:md5,0514ceb1769b2a88843e08c1f82624a9" + "versions.yml:md5,b3b70b126f867fdbb7dcea5e36e49d4a" ] } ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-02-13T16:15:07.857611509" + "timestamp": "2024-07-22T14:19:06.645466" } } \ No newline at end of file diff --git a/modules/nf-core/sourmash/index/main.nf b/modules/nf-core/sourmash/index/main.nf index 5fa12a6..10afe87 100644 --- a/modules/nf-core/sourmash/index/main.nf +++ b/modules/nf-core/sourmash/index/main.nf @@ -9,6 +9,7 @@ process SOURMASH_INDEX { input: tuple val(meta), path(signatures) + val(ksize) output: tuple val(meta), path("*.sbt.zip"), emit: signature_index @@ -18,11 +19,11 @@ process SOURMASH_INDEX { task.ext.when == null || task.ext.when script: - // --ksize needs to be specified with the desired k-mer size to be selected in ext.args def args = task.ext.args ?: "" def prefix = task.ext.prefix ?: "${meta.id}" """ sourmash index \\ + --ksize ${ksize} \\ $args \\ '${prefix}.sbt.zip' \\ $signatures @@ -32,4 +33,15 @@ process SOURMASH_INDEX { sourmash: \$(echo \$(sourmash --version 2>&1) | sed 's/^sourmash //' ) END_VERSIONS """ + + stub: + def prefix = task.ext.prefix ?: "${meta.id}" + """ + touch "${prefix}.sbt.zip" + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + sourmash: \$(echo \$(sourmash --version 2>&1) | sed 's/^sourmash //' ) + END_VERSIONS + """ } diff --git a/modules/nf-core/sourmash/index/meta.yml b/modules/nf-core/sourmash/index/meta.yml index 55898c3..3565596 100644 --- a/modules/nf-core/sourmash/index/meta.yml +++ b/modules/nf-core/sourmash/index/meta.yml @@ -1,4 +1,4 @@ -name: "sourmash_index" +name: sourmash_index description: Create a database of sourmash signatures (a group of FracMinHash sketches) to be used as references. keywords: - signatures @@ -8,13 +8,13 @@ keywords: - mapping - kmer tools: - - "sourmash": + - sourmash: description: "Compute and compare FracMinHash signatures for DNA data sets." homepage: "https://sourmash.readthedocs.io/" documentation: "https://sourmash.readthedocs.io/" tool_dev_url: "https://github.com/sourmash-bio/sourmash" doi: "10.21105/joss.00027" - licence: "['BSD-3-clause']" + licence: ["BSD-3-clause"] input: - meta: type: map diff --git a/modules/nf-core/sourmash/index/tests/main.nf.test b/modules/nf-core/sourmash/index/tests/main.nf.test new file mode 100644 index 0000000..d6df19f --- /dev/null +++ b/modules/nf-core/sourmash/index/tests/main.nf.test @@ -0,0 +1,71 @@ +nextflow_process { + + name "Test Process SOURMASH_INDEX" + script "../main.nf" + process "SOURMASH_INDEX" + + tag "modules" + tag "modules_nfcore" + tag "sourmash" + tag "sourmash/index" + tag "sourmash/sketch" + + setup { + run("SOURMASH_SKETCH") { + script "../../sketch/main.nf" + process { + """ + input[0] = [ + [ id:'test', single_end:false ], // meta map + file(params.test_data['sarscov2']['genome']['genome_fasta'], checkIfExists: true) + ] + """ + } + } + } + + test("sarscov2 genome [fasta]") { + + when { + process { + """ + input[0] = SOURMASH_SKETCH.out.signatures + input[1] = 31 + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out.versions, + file(process.out.signature_index.get(0).get(1)).name) + .match() } + ) + } + + } + + test("sarscov2 genome [fasta] - stub") { + + options "-stub" + + when { + process { + """ + input[0] = SOURMASH_SKETCH.out.signatures + input[1] = 31 + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + + } + +} diff --git a/modules/nf-core/sourmash/index/tests/main.nf.test.snap b/modules/nf-core/sourmash/index/tests/main.nf.test.snap new file mode 100644 index 0000000..473bd7a --- /dev/null +++ b/modules/nf-core/sourmash/index/tests/main.nf.test.snap @@ -0,0 +1,50 @@ +{ + "sarscov2 genome [fasta] - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.sbt.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + "versions.yml:md5,a0f7edb1cdc7f616798c76c05f691c4e" + ], + "signature_index": [ + [ + { + "id": "test", + "single_end": false + }, + "test.sbt.zip:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,a0f7edb1cdc7f616798c76c05f691c4e" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-06-14T08:12:10.771394584" + }, + "sarscov2 genome [fasta]": { + "content": [ + [ + "versions.yml:md5,a0f7edb1cdc7f616798c76c05f691c4e" + ], + "test.sbt.zip" + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-06-14T08:22:00.856863722" + } +} \ No newline at end of file diff --git a/modules/nf-core/sourmash/index/tests/tags.yml b/modules/nf-core/sourmash/index/tests/tags.yml new file mode 100644 index 0000000..ea32aad --- /dev/null +++ b/modules/nf-core/sourmash/index/tests/tags.yml @@ -0,0 +1,2 @@ +sourmash/index: + - "modules/nf-core/sourmash/index/**" diff --git a/modules/nf-core/subread/featurecounts/main.nf b/modules/nf-core/subread/featurecounts/main.nf index 2097996..471bd16 100644 --- a/modules/nf-core/subread/featurecounts/main.nf +++ b/modules/nf-core/subread/featurecounts/main.nf @@ -44,4 +44,16 @@ process SUBREAD_FEATURECOUNTS { subread: \$( echo \$(featureCounts -v 2>&1) | sed -e "s/featureCounts v//g") END_VERSIONS """ + + stub: + def prefix = task.ext.prefix ?: "${meta.id}" + """ + touch ${prefix}.featureCounts.txt + touch ${prefix}.featureCounts.txt.summary + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + subread: \$( echo \$(featureCounts -v 2>&1) | sed -e "s/featureCounts v//g") + END_VERSIONS + """ } diff --git a/modules/nf-core/subread/featurecounts/tests/main.nf.test b/modules/nf-core/subread/featurecounts/tests/main.nf.test index 00d157d..3b95da3 100644 --- a/modules/nf-core/subread/featurecounts/tests/main.nf.test +++ b/modules/nf-core/subread/featurecounts/tests/main.nf.test @@ -14,7 +14,7 @@ nextflow_process { when { process { """ - input[0] = [ + input[0] = [ [ id:'test', single_end:true, strandedness:'forward' ], // meta map file(params.modules_testdata_base_path + "genomics/sarscov2/illumina/bam/test.single_end.bam", checkIfExists: true), file(params.modules_testdata_base_path + "genomics/sarscov2/genome/genome.gtf", checkIfExists: true) @@ -33,12 +33,36 @@ nextflow_process { } } + test("sarscov2 [bam] - forward - stub") { + + options "-stub" + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:true, strandedness:'forward' ], // meta map + file(params.modules_testdata_base_path + "genomics/sarscov2/illumina/bam/test.single_end.bam", checkIfExists: true), + file(params.modules_testdata_base_path + "genomics/sarscov2/genome/genome.gtf", checkIfExists: true) + ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + test("sarscov2 [bam] - reverse") { when { process { """ - input[0] = [ + input[0] = [ [ id:'test', single_end:true, strandedness:'reverse' ], // meta map file(params.modules_testdata_base_path + "genomics/sarscov2/illumina/bam/test.single_end.bam", checkIfExists: true), file(params.modules_testdata_base_path + "genomics/sarscov2/genome/genome.gtf", checkIfExists: true) @@ -57,12 +81,36 @@ nextflow_process { } } + test("sarscov2 [bam] - reverse - stub") { + + options "-stub" + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:true, strandedness:'reverse' ], // meta map + file(params.modules_testdata_base_path + "genomics/sarscov2/illumina/bam/test.single_end.bam", checkIfExists: true), + file(params.modules_testdata_base_path + "genomics/sarscov2/genome/genome.gtf", checkIfExists: true) + ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + test("sarscov2 [bam] - unstranded") { when { process { """ - input[0] = [ + input[0] = [ [ id:'test', single_end:true, strandedness:'unstranded' ], // meta map file(params.modules_testdata_base_path + "genomics/sarscov2/illumina/bam/test.single_end.bam", checkIfExists: true), file(params.modules_testdata_base_path + "genomics/sarscov2/genome/genome.gtf", checkIfExists: true) @@ -80,4 +128,28 @@ nextflow_process { ) } } + + test("sarscov2 [bam] - unstranded - stub") { + + options "-stub" + + when { + process { + """ + input[0] = [ + [ id:'test', single_end:true, strandedness:'unstranded' ], // meta map + file(params.modules_testdata_base_path + "genomics/sarscov2/illumina/bam/test.single_end.bam", checkIfExists: true), + file(params.modules_testdata_base_path + "genomics/sarscov2/genome/genome.gtf", checkIfExists: true) + ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } } diff --git a/modules/nf-core/subread/featurecounts/tests/main.nf.test.snap b/modules/nf-core/subread/featurecounts/tests/main.nf.test.snap index ad5524f..72e8dcd 100644 --- a/modules/nf-core/subread/featurecounts/tests/main.nf.test.snap +++ b/modules/nf-core/subread/featurecounts/tests/main.nf.test.snap @@ -12,6 +12,10 @@ ] ] ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, "timestamp": "2023-11-23T15:50:10.685863663" }, "unstranded_counts": { @@ -27,6 +31,10 @@ ] ] ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, "timestamp": "2023-11-23T15:50:38.67903701" }, "reverse_summary": { @@ -42,8 +50,126 @@ ] ] ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, "timestamp": "2023-11-23T15:50:25.168206514" }, + "sarscov2 [bam] - forward - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": true, + "strandedness": "forward" + }, + "test.featureCounts.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": true, + "strandedness": "forward" + }, + "test.featureCounts.txt.summary:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + "versions.yml:md5,c2c0903b93c93d9afd2667052b9ee726" + ], + "counts": [ + [ + { + "id": "test", + "single_end": true, + "strandedness": "forward" + }, + "test.featureCounts.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "summary": [ + [ + { + "id": "test", + "single_end": true, + "strandedness": "forward" + }, + "test.featureCounts.txt.summary:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,c2c0903b93c93d9afd2667052b9ee726" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-06-21T10:04:22.628032" + }, + "sarscov2 [bam] - reverse - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": true, + "strandedness": "reverse" + }, + "test.featureCounts.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": true, + "strandedness": "reverse" + }, + "test.featureCounts.txt.summary:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + "versions.yml:md5,c2c0903b93c93d9afd2667052b9ee726" + ], + "counts": [ + [ + { + "id": "test", + "single_end": true, + "strandedness": "reverse" + }, + "test.featureCounts.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "summary": [ + [ + { + "id": "test", + "single_end": true, + "strandedness": "reverse" + }, + "test.featureCounts.txt.summary:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,c2c0903b93c93d9afd2667052b9ee726" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-06-21T10:04:52.371212" + }, "reverse_counts": { "content": [ [ @@ -57,8 +183,69 @@ ] ] ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, "timestamp": "2023-11-23T15:50:25.160010804" }, + "sarscov2 [bam] - unstranded - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": true, + "strandedness": "unstranded" + }, + "test.featureCounts.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": true, + "strandedness": "unstranded" + }, + "test.featureCounts.txt.summary:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + "versions.yml:md5,c2c0903b93c93d9afd2667052b9ee726" + ], + "counts": [ + [ + { + "id": "test", + "single_end": true, + "strandedness": "unstranded" + }, + "test.featureCounts.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "summary": [ + [ + { + "id": "test", + "single_end": true, + "strandedness": "unstranded" + }, + "test.featureCounts.txt.summary:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,c2c0903b93c93d9afd2667052b9ee726" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-06-21T10:05:25.058902" + }, "forward_summary": { "content": [ [ @@ -72,6 +259,10 @@ ] ] ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, "timestamp": "2023-11-23T15:50:10.699024934" }, "forward_versions": { @@ -80,6 +271,10 @@ "versions.yml:md5,c2c0903b93c93d9afd2667052b9ee726" ] ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, "timestamp": "2023-11-23T15:50:10.704797013" }, "unstranded_summary": { @@ -95,6 +290,10 @@ ] ] ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, "timestamp": "2023-11-23T15:50:38.68776235" }, "reverse_versions": { @@ -103,6 +302,10 @@ "versions.yml:md5,c2c0903b93c93d9afd2667052b9ee726" ] ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, "timestamp": "2023-11-23T15:50:25.175265594" }, "unstranded_versions": { @@ -111,6 +314,10 @@ "versions.yml:md5,c2c0903b93c93d9afd2667052b9ee726" ] ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, "timestamp": "2023-11-23T15:50:38.69390501" } } \ No newline at end of file diff --git a/modules/nf-core/trimgalore/main.nf b/modules/nf-core/trimgalore/main.nf index 24ead87..0e2f329 100644 --- a/modules/nf-core/trimgalore/main.nf +++ b/modules/nf-core/trimgalore/main.nf @@ -72,4 +72,25 @@ process TRIMGALORE { END_VERSIONS """ } + + stub: + def prefix = task.ext.prefix ?: "${meta.id}" + if (meta.single_end) { + output_command = "echo '' | gzip > ${prefix}_trimmed.fq.gz ;" + output_command += "touch ${prefix}.fastq.gz_trimming_report.txt" + } else { + output_command = "echo '' | gzip > ${prefix}_1_trimmed.fq.gz ;" + output_command += "touch ${prefix}_1.fastq.gz_trimming_report.txt ;" + output_command += "echo '' | gzip > ${prefix}_2_trimmed.fq.gz ;" + output_command += "touch ${prefix}_2.fastq.gz_trimming_report.txt" + } + """ + ${output_command} + + cat <<-END_VERSIONS > versions.yml + "${task.process}": + trimgalore: \$(echo \$(trim_galore --version 2>&1) | sed 's/^.*version //; s/Last.*\$//') + cutadapt: \$(cutadapt --version) + END_VERSIONS + """ } diff --git a/modules/nf-core/trimgalore/tests/main.nf.test b/modules/nf-core/trimgalore/tests/main.nf.test index 43904ac..2a3dbbb 100644 --- a/modules/nf-core/trimgalore/tests/main.nf.test +++ b/modules/nf-core/trimgalore/tests/main.nf.test @@ -44,6 +44,28 @@ nextflow_process { } } + test("test_trimgalore_single_end - stub") { + + options "-stub" + + when { + process { + """ + input[0] = [ [ id:'test', single_end:true ], // meta map + [ file(params.modules_testdata_base_path + "genomics/sarscov2/illumina/fastq/test_1.fastq.gz", checkIfExists: true) ] + ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } + test("test_trimgalore_paired_end") { when { @@ -100,4 +122,29 @@ nextflow_process { ) } } + + test("test_trimgalore_paired_end - stub") { + + options "-stub" + + when { + process { + """ + input[0] = [ [ id:'test', single_end:false ], // meta map + [ + file(params.modules_testdata_base_path + "genomics/sarscov2/illumina/fastq/test_1.fastq.gz", checkIfExists: true), + file(params.modules_testdata_base_path + "genomics/sarscov2/illumina/fastq/test_2.fastq.gz", checkIfExists: true) + ] + ] + """ + } + } + + then { + assertAll( + { assert process.success }, + { assert snapshot(process.out).match() } + ) + } + } } diff --git a/modules/nf-core/trimgalore/tests/main.nf.test.snap b/modules/nf-core/trimgalore/tests/main.nf.test.snap index 082c550..6cb31c9 100644 --- a/modules/nf-core/trimgalore/tests/main.nf.test.snap +++ b/modules/nf-core/trimgalore/tests/main.nf.test.snap @@ -11,6 +11,160 @@ }, "timestamp": "2024-02-29T16:33:20.401347" }, + "test_trimgalore_single_end - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": true + }, + "test_trimmed.fq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastq.gz_trimming_report.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + + ], + "3": [ + + ], + "4": [ + + ], + "5": [ + "versions.yml:md5,47d966cbb31c80eb8f7fe860d55659b7" + ], + "html": [ + + ], + "log": [ + [ + { + "id": "test", + "single_end": true + }, + "test.fastq.gz_trimming_report.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "reads": [ + [ + { + "id": "test", + "single_end": true + }, + "test_trimmed.fq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ], + "unpaired": [ + + ], + "versions": [ + "versions.yml:md5,47d966cbb31c80eb8f7fe860d55659b7" + ], + "zip": [ + + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-06-21T10:27:44.964166" + }, + "test_trimgalore_paired_end - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1_trimmed.fq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test_2_trimmed.fq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1.fastq.gz_trimming_report.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "test_2.fastq.gz_trimming_report.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "2": [ + + ], + "3": [ + + ], + "4": [ + + ], + "5": [ + "versions.yml:md5,47d966cbb31c80eb8f7fe860d55659b7" + ], + "html": [ + + ], + "log": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1.fastq.gz_trimming_report.txt:md5,d41d8cd98f00b204e9800998ecf8427e", + "test_2.fastq.gz_trimming_report.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "reads": [ + [ + { + "id": "test", + "single_end": false + }, + [ + "test_1_trimmed.fq.gz:md5,68b329da9893e34099c7d8ad5cb9c940", + "test_2_trimmed.fq.gz:md5,68b329da9893e34099c7d8ad5cb9c940" + ] + ] + ], + "unpaired": [ + + ], + "versions": [ + "versions.yml:md5,47d966cbb31c80eb8f7fe860d55659b7" + ], + "zip": [ + + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.2" + }, + "timestamp": "2024-06-21T10:28:07.611496" + }, "test_trimgalore_paired_end": { "content": [ [ diff --git a/modules/nf-core/untar/environment.yml b/modules/nf-core/untar/environment.yml index 0c9cbb1..4f49824 100644 --- a/modules/nf-core/untar/environment.yml +++ b/modules/nf-core/untar/environment.yml @@ -1,11 +1,9 @@ name: untar - channels: - conda-forge - bioconda - defaults - dependencies: - conda-forge::grep=3.11 - - conda-forge::sed=4.7 + - conda-forge::sed=4.8 - conda-forge::tar=1.34 diff --git a/modules/nf-core/untar/main.nf b/modules/nf-core/untar/main.nf index 8a75bb9..9bd8f55 100644 --- a/modules/nf-core/untar/main.nf +++ b/modules/nf-core/untar/main.nf @@ -4,8 +4,8 @@ process UNTAR { conda "${moduleDir}/environment.yml" container "${ workflow.containerEngine == 'singularity' && !task.ext.singularity_pull_docker_container ? - 'https://depot.galaxyproject.org/singularity/ubuntu:20.04' : - 'nf-core/ubuntu:20.04' }" + 'https://depot.galaxyproject.org/singularity/ubuntu:22.04' : + 'nf-core/ubuntu:22.04' }" input: tuple val(meta), path(archive) @@ -52,8 +52,29 @@ process UNTAR { stub: prefix = task.ext.prefix ?: ( meta.id ? "${meta.id}" : archive.toString().replaceFirst(/\.[^\.]+(.gz)?$/, "")) """ - mkdir $prefix - touch ${prefix}/file.txt + mkdir ${prefix} + ## Dry-run untaring the archive to get the files and place all in prefix + if [[ \$(tar -taf ${archive} | grep -o -P "^.*?\\/" | uniq | wc -l) -eq 1 ]]; then + for i in `tar -tf ${archive}`; + do + if [[ \$(echo "\${i}" | grep -E "/\$") == "" ]]; + then + touch \${i} + else + mkdir -p \${i} + fi + done + else + for i in `tar -tf ${archive}`; + do + if [[ \$(echo "\${i}" | grep -E "/\$") == "" ]]; + then + touch ${prefix}/\${i} + else + mkdir -p ${prefix}/\${i} + fi + done + fi cat <<-END_VERSIONS > versions.yml "${task.process}": diff --git a/modules/nf-core/untar/tests/main.nf.test b/modules/nf-core/untar/tests/main.nf.test index 2a7c97b..c957517 100644 --- a/modules/nf-core/untar/tests/main.nf.test +++ b/modules/nf-core/untar/tests/main.nf.test @@ -6,6 +6,7 @@ nextflow_process { tag "modules" tag "modules_nfcore" tag "untar" + test("test_untar") { when { @@ -19,10 +20,9 @@ nextflow_process { then { assertAll ( { assert process.success }, - { assert snapshot(process.out.untar).match("test_untar") }, + { assert snapshot(process.out).match() }, ) } - } test("test_untar_onlyfiles") { @@ -38,10 +38,48 @@ nextflow_process { then { assertAll ( { assert process.success }, - { assert snapshot(process.out.untar).match("test_untar_onlyfiles") }, + { assert snapshot(process.out).match() }, ) } + } + + test("test_untar - stub") { + + options "-stub" + when { + process { + """ + input[0] = [ [], file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/db/kraken2.tar.gz', checkIfExists: true) ] + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() }, + ) + } } + test("test_untar_onlyfiles - stub") { + + options "-stub" + + when { + process { + """ + input[0] = [ [], file(params.modules_testdata_base_path + 'generic/tar/hello.tar.gz', checkIfExists: true) ] + """ + } + } + + then { + assertAll ( + { assert process.success }, + { assert snapshot(process.out).match() }, + ) + } + } } diff --git a/modules/nf-core/untar/tests/main.nf.test.snap b/modules/nf-core/untar/tests/main.nf.test.snap index 6455029..ceb91b7 100644 --- a/modules/nf-core/untar/tests/main.nf.test.snap +++ b/modules/nf-core/untar/tests/main.nf.test.snap @@ -1,42 +1,158 @@ { "test_untar_onlyfiles": { "content": [ - [ - [ + { + "0": [ [ - - ], + [ + + ], + [ + "hello.txt:md5,e59ff97941044f85df5297e1c302d260" + ] + ] + ], + "1": [ + "versions.yml:md5,6063247258c56fd271d076bb04dd7536" + ], + "untar": [ + [ + [ + + ], + [ + "hello.txt:md5,e59ff97941044f85df5297e1c302d260" + ] + ] + ], + "versions": [ + "versions.yml:md5,6063247258c56fd271d076bb04dd7536" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-10T12:04:28.231047" + }, + "test_untar_onlyfiles - stub": { + "content": [ + { + "0": [ + [ + [ + + ], + [ + "hello.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "1": [ + "versions.yml:md5,6063247258c56fd271d076bb04dd7536" + ], + "untar": [ [ - "hello.txt:md5,e59ff97941044f85df5297e1c302d260" + [ + + ], + [ + "hello.txt:md5,d41d8cd98f00b204e9800998ecf8427e" + ] ] + ], + "versions": [ + "versions.yml:md5,6063247258c56fd271d076bb04dd7536" ] - ] + } ], "meta": { "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nextflow": "24.04.3" }, - "timestamp": "2024-02-28T11:49:41.320643" + "timestamp": "2024-07-10T12:04:45.773103" + }, + "test_untar - stub": { + "content": [ + { + "0": [ + [ + [ + + ], + [ + "hash.k2d:md5,d41d8cd98f00b204e9800998ecf8427e", + "opts.k2d:md5,d41d8cd98f00b204e9800998ecf8427e", + "taxo.k2d:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "1": [ + "versions.yml:md5,6063247258c56fd271d076bb04dd7536" + ], + "untar": [ + [ + [ + + ], + [ + "hash.k2d:md5,d41d8cd98f00b204e9800998ecf8427e", + "opts.k2d:md5,d41d8cd98f00b204e9800998ecf8427e", + "taxo.k2d:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ] + ], + "versions": [ + "versions.yml:md5,6063247258c56fd271d076bb04dd7536" + ] + } + ], + "meta": { + "nf-test": "0.8.4", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-10T12:04:36.777441" }, "test_untar": { "content": [ - [ - [ + { + "0": [ [ - - ], + [ + + ], + [ + "hash.k2d:md5,8b8598468f54a7087c203ad0190555d9", + "opts.k2d:md5,a033d00cf6759407010b21700938f543", + "taxo.k2d:md5,094d5891cdccf2f1468088855c214b2c" + ] + ] + ], + "1": [ + "versions.yml:md5,6063247258c56fd271d076bb04dd7536" + ], + "untar": [ [ - "hash.k2d:md5,8b8598468f54a7087c203ad0190555d9", - "opts.k2d:md5,a033d00cf6759407010b21700938f543", - "taxo.k2d:md5,094d5891cdccf2f1468088855c214b2c" + [ + + ], + [ + "hash.k2d:md5,8b8598468f54a7087c203ad0190555d9", + "opts.k2d:md5,a033d00cf6759407010b21700938f543", + "taxo.k2d:md5,094d5891cdccf2f1468088855c214b2c" + ] ] + ], + "versions": [ + "versions.yml:md5,6063247258c56fd271d076bb04dd7536" ] - ] + } ], "meta": { "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nextflow": "24.04.3" }, - "timestamp": "2024-02-28T11:49:33.795172" + "timestamp": "2024-07-10T12:04:19.377674" } } \ No newline at end of file diff --git a/subworkflows/nf-core/bam_sort_stats_samtools/tests/main.nf.test b/subworkflows/nf-core/bam_sort_stats_samtools/tests/main.nf.test index 75b5b93..821a3cf 100644 --- a/subworkflows/nf-core/bam_sort_stats_samtools/tests/main.nf.test +++ b/subworkflows/nf-core/bam_sort_stats_samtools/tests/main.nf.test @@ -19,9 +19,6 @@ nextflow_workflow { test("test_bam_sort_stats_samtools_single_end") { when { - params { - outdir = "$outputDir" - } workflow { """ input[0] = Channel.of([ @@ -41,9 +38,11 @@ nextflow_workflow { { assert workflow.success}, { assert workflow.out.bam.get(0).get(1) ==~ ".*.bam"}, { assert workflow.out.bai.get(0).get(1) ==~ ".*.bai"}, - { assert snapshot(workflow.out.stats).match("test_bam_sort_stats_samtools_single_end_stats") }, - { assert snapshot(workflow.out.flagstat).match("test_bam_sort_stats_samtools_single_end_flagstats") }, - { assert snapshot(workflow.out.idxstats).match("test_bam_sort_stats_samtools_single_end_idxstats") } + { assert snapshot( + workflow.out.flagstat, + workflow.out.idxstats, + workflow.out.stats, + workflow.out.versions).match() } ) } } @@ -51,9 +50,6 @@ nextflow_workflow { test("test_bam_sort_stats_samtools_paired_end") { when { - params { - outdir = "$outputDir" - } workflow { """ input[0] = Channel.of([ @@ -73,9 +69,65 @@ nextflow_workflow { { assert workflow.success}, { assert workflow.out.bam.get(0).get(1) ==~ ".*.bam"}, { assert workflow.out.bai.get(0).get(1) ==~ ".*.bai"}, - { assert snapshot(workflow.out.stats).match("test_bam_sort_stats_samtools_paired_end_stats") }, - { assert snapshot(workflow.out.flagstat).match("test_bam_sort_stats_samtools_paired_end_flagstats") }, - { assert snapshot(workflow.out.idxstats).match("test_bam_sort_stats_samtools_paired_end_idxstats") } + { assert snapshot( + workflow.out.flagstat, + workflow.out.idxstats, + workflow.out.stats, + workflow.out.versions).match() } + ) + } + } + + test("test_bam_sort_stats_samtools_single_end - stub") { + + options "-stub" + + when { + workflow { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.single_end.bam', checkIfExists: true) + ]) + input[1] = Channel.of([ + [ id:'genome' ], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll( + { assert workflow.success}, + { assert snapshot(workflow.out).match() } + ) + } + } + + test("test_bam_sort_stats_samtools_paired_end - stub") { + + options "-stub" + + when { + workflow { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.bam', checkIfExists: true) + ]) + input[1] = Channel.of([ + [ id:'genome' ], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll( + { assert workflow.success}, + { assert snapshot(workflow.out).match() } ) } } diff --git a/subworkflows/nf-core/bam_sort_stats_samtools/tests/main.nf.test.snap b/subworkflows/nf-core/bam_sort_stats_samtools/tests/main.nf.test.snap index db06383..b7f4da1 100644 --- a/subworkflows/nf-core/bam_sort_stats_samtools/tests/main.nf.test.snap +++ b/subworkflows/nf-core/bam_sort_stats_samtools/tests/main.nf.test.snap @@ -1,5 +1,5 @@ { - "test_bam_sort_stats_samtools_paired_end_flagstats": { + "test_bam_sort_stats_samtools_single_end": { "content": [ [ [ @@ -7,36 +7,18 @@ "id": "test", "single_end": false }, - "test.flagstat:md5,4f7ffd1e6a5e85524d443209ac97d783" + "test.flagstat:md5,2191911d72575a2358b08b1df64ccb53" ] - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2023-10-22T20:25:03.687121177" - }, - "test_bam_sort_stats_samtools_paired_end_idxstats": { - "content": [ + ], [ [ { "id": "test", "single_end": false }, - "test.idxstats:md5,df60a8c8d6621100d05178c93fb053a2" + "test.idxstats:md5,613e048487662c694aa4a2f73ca96a20" ] - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2023-10-22T20:25:03.709648916" - }, - "test_bam_sort_stats_samtools_single_end_stats": { - "content": [ + ], [ [ { @@ -45,15 +27,22 @@ }, "test.stats:md5,d32de3b3716a11039cef2367c3c1a56e" ] + ], + [ + "versions.yml:md5,494b5530a1aa29fd5867cf655bebbfe1", + "versions.yml:md5,9fcb0cd845bfb1f89d83201bb20649b4", + "versions.yml:md5,bacc323ec4055d6f69f07a09089772d1", + "versions.yml:md5,ce946e97097c6a9ccf834a3f91f6da30", + "versions.yml:md5,d6c8dae685f1b7d050165fc15c7a20b5" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-05-29T07:47:44.044172487" + "timestamp": "2024-07-22T17:02:44.34964" }, - "test_bam_sort_stats_samtools_paired_end_stats": { + "test_bam_sort_stats_samtools_paired_end": { "content": [ [ [ @@ -61,50 +50,281 @@ "id": "test", "single_end": false }, - "test.stats:md5,cca83e4fc9406fc3875b5e60055d6574" + "test.flagstat:md5,4f7ffd1e6a5e85524d443209ac97d783" ] - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "23.10.1" - }, - "timestamp": "2024-05-29T07:47:51.426232891" - }, - "test_bam_sort_stats_samtools_single_end_idxstats": { - "content": [ + ], [ [ { "id": "test", "single_end": false }, - "test.idxstats:md5,613e048487662c694aa4a2f73ca96a20" + "test.idxstats:md5,df60a8c8d6621100d05178c93fb053a2" ] - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-01-18T17:10:02.84631" - }, - "test_bam_sort_stats_samtools_single_end_flagstats": { - "content": [ + ], [ [ { "id": "test", "single_end": false }, - "test.flagstat:md5,2191911d72575a2358b08b1df64ccb53" + "test.stats:md5,cca83e4fc9406fc3875b5e60055d6574" ] + ], + [ + "versions.yml:md5,494b5530a1aa29fd5867cf655bebbfe1", + "versions.yml:md5,9fcb0cd845bfb1f89d83201bb20649b4", + "versions.yml:md5,bacc323ec4055d6f69f07a09089772d1", + "versions.yml:md5,ce946e97097c6a9ccf834a3f91f6da30", + "versions.yml:md5,d6c8dae685f1b7d050165fc15c7a20b5" ] ], "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T17:03:02.583095" + }, + "test_bam_sort_stats_samtools_single_end - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + + ], + "3": [ + [ + { + "id": "test", + "single_end": false + }, + "test.stats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "4": [ + [ + { + "id": "test", + "single_end": false + }, + "test.flagstat:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "5": [ + [ + { + "id": "test", + "single_end": false + }, + "test.idxstats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "6": [ + "versions.yml:md5,494b5530a1aa29fd5867cf655bebbfe1", + "versions.yml:md5,9fcb0cd845bfb1f89d83201bb20649b4", + "versions.yml:md5,bacc323ec4055d6f69f07a09089772d1", + "versions.yml:md5,ce946e97097c6a9ccf834a3f91f6da30", + "versions.yml:md5,d6c8dae685f1b7d050165fc15c7a20b5" + ], + "bai": [ + [ + { + "id": "test", + "single_end": false + }, + "test.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "bam": [ + [ + { + "id": "test", + "single_end": false + }, + "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "csi": [ + + ], + "flagstat": [ + [ + { + "id": "test", + "single_end": false + }, + "test.flagstat:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "idxstats": [ + [ + { + "id": "test", + "single_end": false + }, + "test.idxstats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "stats": [ + [ + { + "id": "test", + "single_end": false + }, + "test.stats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,494b5530a1aa29fd5867cf655bebbfe1", + "versions.yml:md5,9fcb0cd845bfb1f89d83201bb20649b4", + "versions.yml:md5,bacc323ec4055d6f69f07a09089772d1", + "versions.yml:md5,ce946e97097c6a9ccf834a3f91f6da30", + "versions.yml:md5,d6c8dae685f1b7d050165fc15c7a20b5" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" + }, + "timestamp": "2024-07-22T17:03:22.328703" + }, + "test_bam_sort_stats_samtools_paired_end - stub": { + "content": [ + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + + ], + "3": [ + [ + { + "id": "test", + "single_end": false + }, + "test.stats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "4": [ + [ + { + "id": "test", + "single_end": false + }, + "test.flagstat:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "5": [ + [ + { + "id": "test", + "single_end": false + }, + "test.idxstats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "6": [ + "versions.yml:md5,494b5530a1aa29fd5867cf655bebbfe1", + "versions.yml:md5,9fcb0cd845bfb1f89d83201bb20649b4", + "versions.yml:md5,bacc323ec4055d6f69f07a09089772d1", + "versions.yml:md5,ce946e97097c6a9ccf834a3f91f6da30", + "versions.yml:md5,d6c8dae685f1b7d050165fc15c7a20b5" + ], + "bai": [ + [ + { + "id": "test", + "single_end": false + }, + "test.bam.bai:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "bam": [ + [ + { + "id": "test", + "single_end": false + }, + "test.bam:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "csi": [ + + ], + "flagstat": [ + [ + { + "id": "test", + "single_end": false + }, + "test.flagstat:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "idxstats": [ + [ + { + "id": "test", + "single_end": false + }, + "test.idxstats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "stats": [ + [ + { + "id": "test", + "single_end": false + }, + "test.stats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,494b5530a1aa29fd5867cf655bebbfe1", + "versions.yml:md5,9fcb0cd845bfb1f89d83201bb20649b4", + "versions.yml:md5,bacc323ec4055d6f69f07a09089772d1", + "versions.yml:md5,ce946e97097c6a9ccf834a3f91f6da30", + "versions.yml:md5,d6c8dae685f1b7d050165fc15c7a20b5" + ] + } + ], + "meta": { + "nf-test": "0.9.0", + "nextflow": "24.04.3" }, - "timestamp": "2024-01-18T17:10:02.829756" + "timestamp": "2024-07-22T17:03:38.833662" } } \ No newline at end of file diff --git a/subworkflows/nf-core/bam_stats_samtools/tests/main.nf.test b/subworkflows/nf-core/bam_stats_samtools/tests/main.nf.test index c8b21f2..76e7a40 100644 --- a/subworkflows/nf-core/bam_stats_samtools/tests/main.nf.test +++ b/subworkflows/nf-core/bam_stats_samtools/tests/main.nf.test @@ -15,9 +15,6 @@ nextflow_workflow { test("test_bam_stats_samtools_single_end") { when { - params { - outdir = "$outputDir" - } workflow { """ input[0] = Channel.of([ @@ -36,9 +33,11 @@ nextflow_workflow { then { assertAll( { assert workflow.success}, - { assert snapshot(workflow.out.stats).match("test_bam_stats_samtools_single_end_stats") }, - { assert snapshot(workflow.out.flagstat).match("test_bam_stats_samtools_single_end_flagstats") }, - { assert snapshot(workflow.out.idxstats).match("test_bam_stats_samtools_single_end_idxstats") } + { assert snapshot( + workflow.out.flagstat, + workflow.out.idxstats, + workflow.out.stats, + workflow.out.versions).match() } ) } } @@ -46,9 +45,6 @@ nextflow_workflow { test("test_bam_stats_samtools_paired_end") { when { - params { - outdir = "$outputDir" - } workflow { """ input[0] = Channel.of([ @@ -67,9 +63,11 @@ nextflow_workflow { then { assertAll( { assert workflow.success }, - { assert snapshot(workflow.out.stats).match("test_bam_stats_samtools_paired_end_stats") }, - { assert snapshot(workflow.out.flagstat).match("test_bam_stats_samtools_paired_end_flagstats") }, - { assert snapshot(workflow.out.idxstats).match("test_bam_stats_samtools_paired_end_idxstats") } + { assert snapshot( + workflow.out.flagstat, + workflow.out.idxstats, + workflow.out.stats, + workflow.out.versions).match() } ) } } @@ -77,9 +75,6 @@ nextflow_workflow { test("test_bam_stats_samtools_paired_end_cram") { when { - params { - outdir = "$outputDir" - } workflow { """ input[0] = Channel.of([ @@ -98,11 +93,96 @@ nextflow_workflow { then { assertAll( { assert workflow.success}, - { assert snapshot(workflow.out.stats).match("test_bam_stats_samtools_paired_end_cram_stats") }, - { assert snapshot(workflow.out.flagstat).match("test_bam_stats_samtools_paired_end_cram_flagstats") }, - { assert snapshot(workflow.out.idxstats).match("test_bam_stats_samtools_paired_end_cram_idxstats") } + { assert snapshot( + workflow.out.flagstat, + workflow.out.idxstats, + workflow.out.stats, + workflow.out.versions).match() } ) } } + test ("test_bam_stats_samtools_single_end - stub") { + + options "-stub" + + when { + workflow { + """ + input[0] = Channel.of([ + [ id:'test', single_end:true ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.single_end.sorted.bam', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.single_end.sorted.bam.bai', checkIfExists: true) + ]) + input[1] = Channel.of([ + [ id:'genome' ], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll( + { assert workflow.success}, + { assert snapshot(workflow.out).match() } + ) + } + } + + test("test_bam_stats_samtools_paired_end - stub") { + + options "-stub" + + when { + workflow { + """ + input[0] = Channel.of([ + [ id:'test', single_end:true ], // meta map + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/sarscov2/illumina/bam/test.paired_end.sorted.bam.bai', checkIfExists: true) + ]) + input[1] = Channel.of([ + [ id:'genome' ], + file(params.modules_testdata_base_path + 'genomics/sarscov2/genome/genome.fasta', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll( + { assert workflow.success }, + { assert snapshot(workflow.out).match() } + ) + } + } + + test("test_bam_stats_samtools_paired_end_cram - stub") { + + options "-stub" + + when { + workflow { + """ + input[0] = Channel.of([ + [ id:'test', single_end:false ], // meta map + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram', checkIfExists: true), + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/illumina/cram/test.paired_end.sorted.cram.crai', checkIfExists: true) + ]) + input[1] = Channel.of([ + [ id:'genome' ], + file(params.modules_testdata_base_path + 'genomics/homo_sapiens/genome/genome.fasta', checkIfExists: true) + ]) + """ + } + } + + then { + assertAll( + { assert workflow.success}, + { assert snapshot(workflow.out).match() } + ) + } + } } diff --git a/subworkflows/nf-core/bam_stats_samtools/tests/main.nf.test.snap b/subworkflows/nf-core/bam_stats_samtools/tests/main.nf.test.snap index c2cb4de..a3ddcc5 100644 --- a/subworkflows/nf-core/bam_stats_samtools/tests/main.nf.test.snap +++ b/subworkflows/nf-core/bam_stats_samtools/tests/main.nf.test.snap @@ -1,59 +1,230 @@ { - "test_bam_stats_samtools_paired_end_cram_flagstats": { + "test_bam_stats_samtools_paired_end - stub": { "content": [ - [ - [ - { - "id": "test", - "single_end": false - }, - "test.flagstat:md5,a53f3d26e2e9851f7d528442bbfe9781" + { + "0": [ + [ + { + "id": "test", + "single_end": true + }, + "test.stats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": true + }, + "test.flagstat:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + [ + { + "id": "test", + "single_end": true + }, + "test.idxstats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + "versions.yml:md5,3c485730f712b115bcdc235e7294133b", + "versions.yml:md5,90f593a26a2d53e0f0345df7888f448e", + "versions.yml:md5,9ae003814e63a0907d52eec64d5d3ca3" + ], + "flagstat": [ + [ + { + "id": "test", + "single_end": true + }, + "test.flagstat:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "idxstats": [ + [ + { + "id": "test", + "single_end": true + }, + "test.idxstats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "stats": [ + [ + { + "id": "test", + "single_end": true + }, + "test.stats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,3c485730f712b115bcdc235e7294133b", + "versions.yml:md5,90f593a26a2d53e0f0345df7888f448e", + "versions.yml:md5,9ae003814e63a0907d52eec64d5d3ca3" ] - ] + } ], "meta": { "nf-test": "0.8.4", - "nextflow": "24.01.0" + "nextflow": "24.04.2" }, - "timestamp": "2023-11-06T09:31:26.194017574" + "timestamp": "2024-07-03T12:20:06.699297" }, - "test_bam_stats_samtools_paired_end_stats": { + "test_bam_stats_samtools_single_end - stub": { "content": [ - [ - [ - { - "id": "test", - "single_end": true - }, - "test.stats:md5,7afd486ad6abb9a2a3dac90c99e1d87b" + { + "0": [ + [ + { + "id": "test", + "single_end": true + }, + "test.stats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": true + }, + "test.flagstat:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + [ + { + "id": "test", + "single_end": true + }, + "test.idxstats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + "versions.yml:md5,3c485730f712b115bcdc235e7294133b", + "versions.yml:md5,90f593a26a2d53e0f0345df7888f448e", + "versions.yml:md5,9ae003814e63a0907d52eec64d5d3ca3" + ], + "flagstat": [ + [ + { + "id": "test", + "single_end": true + }, + "test.flagstat:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "idxstats": [ + [ + { + "id": "test", + "single_end": true + }, + "test.idxstats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "stats": [ + [ + { + "id": "test", + "single_end": true + }, + "test.stats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,3c485730f712b115bcdc235e7294133b", + "versions.yml:md5,90f593a26a2d53e0f0345df7888f448e", + "versions.yml:md5,9ae003814e63a0907d52eec64d5d3ca3" ] - ] + } ], "meta": { "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nextflow": "24.04.2" }, - "timestamp": "2024-05-29T07:46:05.502831991" + "timestamp": "2024-07-03T12:19:57.708621" }, - "test_bam_stats_samtools_paired_end_flagstats": { + "test_bam_stats_samtools_paired_end_cram - stub": { "content": [ - [ - [ - { - "id": "test", - "single_end": true - }, - "test.flagstat:md5,4f7ffd1e6a5e85524d443209ac97d783" + { + "0": [ + [ + { + "id": "test", + "single_end": false + }, + "test.stats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "1": [ + [ + { + "id": "test", + "single_end": false + }, + "test.flagstat:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "2": [ + [ + { + "id": "test", + "single_end": false + }, + "test.idxstats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "3": [ + "versions.yml:md5,3c485730f712b115bcdc235e7294133b", + "versions.yml:md5,90f593a26a2d53e0f0345df7888f448e", + "versions.yml:md5,9ae003814e63a0907d52eec64d5d3ca3" + ], + "flagstat": [ + [ + { + "id": "test", + "single_end": false + }, + "test.flagstat:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "idxstats": [ + [ + { + "id": "test", + "single_end": false + }, + "test.idxstats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "stats": [ + [ + { + "id": "test", + "single_end": false + }, + "test.stats:md5,d41d8cd98f00b204e9800998ecf8427e" + ] + ], + "versions": [ + "versions.yml:md5,3c485730f712b115bcdc235e7294133b", + "versions.yml:md5,90f593a26a2d53e0f0345df7888f448e", + "versions.yml:md5,9ae003814e63a0907d52eec64d5d3ca3" ] - ] + } ], "meta": { "nf-test": "0.8.4", - "nextflow": "24.01.0" + "nextflow": "24.04.2" }, - "timestamp": "2024-01-18T17:17:27.717482" + "timestamp": "2024-07-03T12:20:17.051493" }, - "test_bam_stats_samtools_single_end_flagstats": { + "test_bam_stats_samtools_single_end": { "content": [ [ [ @@ -63,34 +234,16 @@ }, "test.flagstat:md5,2191911d72575a2358b08b1df64ccb53" ] - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2023-11-06T09:26:10.340046381" - }, - "test_bam_stats_samtools_paired_end_cram_idxstats": { - "content": [ + ], [ [ { "id": "test", - "single_end": false + "single_end": true }, - "test.idxstats:md5,e179601fa7b8ebce81ac3765206f6c15" + "test.idxstats:md5,613e048487662c694aa4a2f73ca96a20" ] - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2023-11-06T09:31:26.207052003" - }, - "test_bam_stats_samtools_single_end_stats": { - "content": [ + ], [ [ { @@ -99,16 +252,30 @@ }, "test.stats:md5,4a0c429c661d6aa0b60acb9309da642d" ] + ], + [ + "versions.yml:md5,3c485730f712b115bcdc235e7294133b", + "versions.yml:md5,90f593a26a2d53e0f0345df7888f448e", + "versions.yml:md5,9ae003814e63a0907d52eec64d5d3ca3" ] ], "meta": { "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nextflow": "24.04.2" }, - "timestamp": "2024-05-29T07:45:59.612412212" + "timestamp": "2024-07-03T12:19:25.801394" }, - "test_bam_stats_samtools_paired_end_idxstats": { + "test_bam_stats_samtools_paired_end": { "content": [ + [ + [ + { + "id": "test", + "single_end": true + }, + "test.flagstat:md5,4f7ffd1e6a5e85524d443209ac97d783" + ] + ], [ [ { @@ -117,34 +284,48 @@ }, "test.idxstats:md5,df60a8c8d6621100d05178c93fb053a2" ] - ] - ], - "meta": { - "nf-test": "0.8.4", - "nextflow": "24.01.0" - }, - "timestamp": "2024-01-18T17:17:27.726719" - }, - "test_bam_stats_samtools_single_end_idxstats": { - "content": [ + ], [ [ { "id": "test", "single_end": true }, - "test.idxstats:md5,613e048487662c694aa4a2f73ca96a20" + "test.stats:md5,7afd486ad6abb9a2a3dac90c99e1d87b" ] + ], + [ + "versions.yml:md5,3c485730f712b115bcdc235e7294133b", + "versions.yml:md5,90f593a26a2d53e0f0345df7888f448e", + "versions.yml:md5,9ae003814e63a0907d52eec64d5d3ca3" ] ], "meta": { "nf-test": "0.8.4", - "nextflow": "24.01.0" + "nextflow": "24.04.2" }, - "timestamp": "2023-11-06T09:26:10.349439801" + "timestamp": "2024-07-03T12:19:36.158768" }, - "test_bam_stats_samtools_paired_end_cram_stats": { + "test_bam_stats_samtools_paired_end_cram": { "content": [ + [ + [ + { + "id": "test", + "single_end": false + }, + "test.flagstat:md5,a53f3d26e2e9851f7d528442bbfe9781" + ] + ], + [ + [ + { + "id": "test", + "single_end": false + }, + "test.idxstats:md5,e179601fa7b8ebce81ac3765206f6c15" + ] + ], [ [ { @@ -153,12 +334,17 @@ }, "test.stats:md5,16b59a1f2c99d9fe30f711adc3ebe32d" ] + ], + [ + "versions.yml:md5,3c485730f712b115bcdc235e7294133b", + "versions.yml:md5,90f593a26a2d53e0f0345df7888f448e", + "versions.yml:md5,9ae003814e63a0907d52eec64d5d3ca3" ] ], "meta": { "nf-test": "0.8.4", - "nextflow": "23.10.1" + "nextflow": "24.04.2" }, - "timestamp": "2024-05-29T07:46:11.96999343" + "timestamp": "2024-07-03T12:19:46.625907" } } \ No newline at end of file From e9341ca877cf78c54da54256e247a2d1c6e40985 Mon Sep 17 00:00:00 2001 From: Danilo Di Leo Date: Tue, 23 Jul 2024 14:38:27 +0200 Subject: [PATCH 2/3] changes based on modules update --- conf/modules.config | 4 ---- subworkflows/local/sourmash.nf | 3 ++- workflows/magmap.nf | 6 ++++-- 3 files changed, 6 insertions(+), 7 deletions(-) diff --git a/conf/modules.config b/conf/modules.config index c81e510..d2e0b50 100644 --- a/conf/modules.config +++ b/conf/modules.config @@ -81,10 +81,6 @@ process { ext.args = '--threshold-bp "50"' } - withName: 'SOURMASH_INDEX' { - ext.args = "--ksize ${params.ksize}" - } - withName: 'GINDEX_CAT' { publishDir = [ path: { "${params.outdir}/concatenate" }, diff --git a/subworkflows/local/sourmash.nf b/subworkflows/local/sourmash.nf index 9a1909a..a6c248d 100644 --- a/subworkflows/local/sourmash.nf +++ b/subworkflows/local/sourmash.nf @@ -13,6 +13,7 @@ workflow SOURMASH { ch_indexes ch_user_genomeinfo ch_ncbi_genomeinfo_files + ksize main: // I like that you create named variables for these, but they look more like config file @@ -54,7 +55,7 @@ workflow SOURMASH { .map{ sig -> [ [id: 'signatures'], sig ] } .set { ch_genome_sigs } - GENOMES_INDEX(ch_genome_sigs) + GENOMES_INDEX(ch_genome_sigs, ksize) GENOMES_INDEX.out.signature_index .map{ meta, sig -> sig } diff --git a/workflows/magmap.nf b/workflows/magmap.nf index ba1ced7..d4d7c91 100644 --- a/workflows/magmap.nf +++ b/workflows/magmap.nf @@ -472,7 +472,7 @@ workflow MAGMAP { // // we create a channel for ncbi genomes only when sourmash is called if ( params.sourmash ) { - SOURMASH(ch_clean_reads, ch_indexes, ch_genomeinfo, ch_genome_infos) + SOURMASH(ch_clean_reads, ch_indexes, ch_genomeinfo, ch_genome_infos, params.ksize) ch_versions = ch_versions.mix(SOURMASH.out.versions) ch_genomes = SOURMASH.out.filtered_genomes } else { @@ -662,7 +662,9 @@ workflow MAGMAP { ch_multiqc_files.collect(), ch_multiqc_config.toList(), ch_multiqc_custom_config.toList(), - ch_multiqc_logo.toList() + ch_multiqc_logo.toList(), + [], + [] ) emit: From 80258a3fc43739f7d1fbb5c8a3e5c10ff0fd2186 Mon Sep 17 00:00:00 2001 From: Danilo Di Leo Date: Wed, 24 Jul 2024 10:59:59 +0200 Subject: [PATCH 3/3] optional parameter for printing bbmap index output --- conf/modules.config | 11 +++++++++++ nextflow.config | 1 + nextflow_schema.json | 4 ++++ 3 files changed, 16 insertions(+) diff --git a/conf/modules.config b/conf/modules.config index d2e0b50..8e9843e 100644 --- a/conf/modules.config +++ b/conf/modules.config @@ -106,6 +106,17 @@ process { ] } + withName: BBMAP_INDEX { + publishDir = [ + [ + path: { "${params.outdir}/bbmap/" }, + mode: 'copy', + pattern: "*", + enabled: params.save_bbmap_index + ] + ] + } + withName: SAMTOOLS_SORT { ext.prefix = { "${meta.id}.sorted" } } diff --git a/nextflow.config b/nextflow.config index ea17c03..2f6004b 100644 --- a/nextflow.config +++ b/nextflow.config @@ -39,6 +39,7 @@ params { bbmap_minid = 0.9 sequence_filter = null save_bam = false + save_bbmap_index = false // MultiQC options multiqc_config = null diff --git a/nextflow_schema.json b/nextflow_schema.json index c39ce5f..37763d1 100644 --- a/nextflow_schema.json +++ b/nextflow_schema.json @@ -139,6 +139,10 @@ "save_bam": { "type": "boolean", "description": "Save bam output file" + }, + "save_bbmap_index": { + "type": "boolean", + "description": "Save ref folder containing the reference index" } } },