TrimGalore: Error in FastQ file

[yaaminiv]

I ran this script to trim adapter sequences out of some killifish RRBS data and ran into an error for one sample. No one in my lab has seen this error before, but I'm wondering if anyone here has experience with it!

Here's the error:

Using Illumina adapter for trimming (count: 10552). Second best hit was smallRNA (count: 0)

Writing report to '/vortexfs1/scratch/yaamini.venkataraman/02-trimgalore/190626_I114_FCH7TVNBBXY_L4_OC-N3_1.fq.gz_trimming_report.txt'

SUMMARISING RUN PARAMETERS
==========================
Input filename: /vortexfs1/home/naluru/Killifish/WHOI-Mummichog_RRBS/190626_I114_FCH7TVNBBXY_L4_OC-N3_1.fq.gz
Trimming mode: paired-end
Trim Galore version: 0.6.6
Cutadapt version: 3.5
Number of cores used for trimming: 1
Quality Phred score cutoff: 20
Quality encoding type selected: ASCII+33
Adapter sequence: 'AGATCGGAAGAGC' (Illumina TruSeq, Sanger iPCR; auto-detected)
Maximum trimming error rate: 0.1 (default)
Minimum required adapter overlap (stringency): 1 bp
Minimum required sequence length for both reads before a sequence pair gets removed: 20 bp
File was specified to be an MspI-digested RRBS sample. Read 1 sequences with adapter contamination will be trimmed a further 2 bp from their 3' end, and Read 2 sequences will be trimmed by 2 bp from their 5' end to remove potential methylation-biased bases from the end-repair reaction
File was specified to be a non-directional MspI-digested RRBS sample. Sequences starting with either 'CAA' or 'CGA' will have the first 2 bp trimmed off to remove potential methylation-biased bases from the end-repair reaction
Running FastQC on the data once trimming has completed
Running FastQC with the following extra arguments: '--outdir /vortexfs1/scratch/yaamini.venkataraman/02-trimgalore --threads 28'
Output file(s) will be GZIP compressed

Cutadapt seems to be fairly up-to-date (version 3.5). Setting -j 1
  >>> Now performing adaptive quality trimming with a Phred-score cutoff of: 20 <<<

This is cutadapt 3.5 with Python 3.9.5
Command line parameters: -j 1 -e 0.1 -q 20 -a X /vortexfs1/home/naluru/Killifish/WHOI-Mummichog_RRBS/190626_I114_FCH7TVNBBXY_L4_OC-N3_1.fq.gz
Processing reads on 1 core in single-end mode ...
10000000 sequences processed
20000000 sequences processed
cutadapt: error: Error in FASTQ file at line 91357035: Line expected to start with '+', but found '@'

  >>> Quality trimming completed <<<
22839258 sequences processed in total

Unable to close QUAL filehandle:

I removed this sample and ran the rest of my script successfully, including multiqc, so it's isolated to this specific sample. I extracted the sequence with the error, as well as upstream and downstream sequences with zcat 190626_I114_FCH7TVNBBXY_L4_OC-N3_1.fq.gz | sed -n '91357028,91357032p;91357041q':

AAFFFJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJ
@K00114:958:H7TVNBBXY:4:2218:9435:44535 1:N:0:TATAATAT_AGATCTCG
TGGTAAGTTGAGAGTGATAGTTTTTTTTGGTTTGGTTTGTTTTTTGTTT
+
AAFFFJJJJJJJJJFJJJJJJJJJJJJJJJJJJJFJFJJJFJJJJJJJJ
@K00114:958:H7TVNBBXY:4:2218:10044:44535 1:N:0:TATAATAT_AGACCTCA
T:2218:7FJFAFJJJFAJJJJJJFJFFJFFFJJJJJFJJJJJJA<
@K00114:958:H7TVNBBXY:4:2218:32684:44517 1:N:0:TATAATAA_AAACCCCG # Line with issue
GGAGGGTGTCAATCCTGACGGTTATTTCCTAGCCAACTTAGAGCCAATA
+
<AA-FF-A-AAFJJFA7AF7AFFJ-77FAFJ--A<--<77<7-7---7F
@K00114:958:H7TVNBBXY:4:2218:1641:44535 1:N:0:NATAATAT_NGATCTCG
NGAAAAAAATGGTATAAATTGGAATGATGTTTTTTCGTTATTATATTTA

It looks like the second sequence, @K00114:958:H7TVNBBXY:4:2218:10044:44535 1:N:0:TATAATAT_AGACCTCA...T:2218:7FJFAFJJJFAJJJJJJFJFFJFFFJJJJJFJJJJJJA< may not have the correct balance of sequence and quality information that the other sequences do. Is this something I'm supposed to manually go in and edit, or is there something else I should do?

[kubu4]

First thing I would do is confirm MD5 checksums match those issued by the sequencing facility. This will tell you whether or not the file is corrupted. It looks corrupted, btw. Each read should have four lines associated with it. This section has more than that:

AAFFFJJJJJJJJJFJJJJJJJJJJJJJJJJJJJFJFJJJFJJJJJJJJ
@K00114:958:H7TVNBBXY:4:2218:10044:44535 1:N:0:TATAATAT_AGACCTCA
T:2218:7FJFAFJJJFAJJJJJJFJFFJFFFJJJJJFJJJJJJA<
@K00114:958:H7TVNBBXY:4:2218:32684:44517 1:N:0:TATAATAA_AAACCCCG # Line with issue
GGAGGGTGTCAATCCTGACGGTTATTTCCTAGCCAACTTAGAGCCAATA

If it's corrupted, re-download and confirm MD5 checksums match.

If not corrupted, try trimming with different trimming software and see if it's an issue specific to TrimGalore.